C hisleuleuleuthrglnleucysserleualathrserasnarghishis

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: operties) TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCC 0 10 C. Major missense (very different properties) a: METValHisLeuThrProGluGluLysSerALAValThrAlaLeuTrpGly b: D. Frame-shift TrpCysThrEndLeuLeuArgArgSerLeuProLeuLeuProCysGlyAlac: E . GlyAlaProAspSerEndGlyGluValCysArgTyrCysProValGly Major, non-frameshift, change in many amino acids a: b: c: CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTAT 201 ---------+---------+---------+---------+---------+250 GTTCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCAACCATA 20 30 LysValAsnVALAspGluValGlyGlyGluAlaLeuGlyARGLeuValSerArgEndThrTrpMetLysLeuValValArgProTrpAlaGlyTrpTyr GlnGlyGluArgGlyEndSerTrpTrpEndGlyProGlyGlnValGlyIle - GlnGluProGlyLeuGlyIleLysValArgAlaGluProSerIleAlaTyrArgSerGlnGlyTrpAlaEndLysSerGlyGlnSerHisLeuLeuLeu iClicker Question 4: AlaGlyAlaArgAlaGlyHisLysSerGlnGlyArgAlaIleTyrCysLeu - One kind of beta- zero- thalassemia is caused by the start of mRNA mutation G197A. What kind of mutation is G197 A? ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC 101 ---------+---------+---------+---------+---------+150 A. Silent B. TGTAAACGAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGG Minor missense (~similar properties) C. Major missense (very different properties) IleCysPheEndHisAsnCysValHisEndGlnProGlnThrAspThr D. Thr...
View Full Document

Ask a homework question - tutors are online