Intron 2 a b a c b c

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: --------+---------+---------+450 TCCAAGAAACTCAGGAAACCCCTAGACAGGTGAGGACTACGACAATACCC 551 ---------+---------+---------+---------+---------+600 40 50 CTCGACGTGACACTGTTCGACGTGCACCTAGGACTCTTGAAGTCCCACTC ValLeuEndValLeuTrpGlySerValHisSerEndCysCysTyrGly 90 100 104 ARAlaAlaLeuEndGlnAlaAlaArgGlySerEndGluLeuGlnGlyGlu -GPhePheGluSerPheGlyAspLeuSerTHRProAspAlaValMetGly GlySerLeuSerProLeuGlyIleCysProLeuLeuMetLeuLeuTrpAlaGLULeuHisCysAspLysLeuHisValAspPROGluAsnPheARGValSer SerCysThrValThrSerCysThrTrpIleLeuArgThrSerGlyEndVal- a: CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTG 451 ---------+---------+---------+---------+---------+500 TCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTT GTTGGGATTCCACTTCCGAGTACCGTTCTTTCACGAGCCACGGAAATCAC 601 ---------+---------+---------+---------+---------+650 60 70 AGATACCCTGGGAACTACAAAAGAAAGGGGAAGAAAAGATACCAATTCAA GlnProEndGlyGluGlySerTrpGlnGluSerAlaArgCysLeuEndEnd a: b: c: LeuLeuPheTyrGlyTrpAspLysAlaGlyLeuPheEndValGlnAlaArg PheTyrPheMetValGlyIleArgLeuAspTyrSerGluSerLysLeuGlyPheIleLeuTrpLeuGlyEndGlyTrpIleIleLeuSerProSerEnd - APAIB page 253 The end of intron 2 & start of exon 3 GCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCT 1401 ---------+---------+---------+---------+---------1450 CCGGGAAAACGATTAGTACAAGTATGGAGAATAGAAGGAGGGTGTCGAGGA CCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT 105 1501 ---------+---------+--...
View Full Document

This note was uploaded on 03/28/2014 for the course BIO 111 taught by Professor White during the Fall '11 term at University of Massachusetts Boston.

Ask a homework question - tutors are online