Part of the beta globin gene a exon 1 b intron 1 c

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: spThrThrValPheThrSerAsnLeuLysGlnThrPro c: HisLeuLeuLeuThrGlnLeuCysSerLeuAlaThrSerAsnArgHisHis- Hemoglobin Volga is caused by the mutation C233A. What kind of mutation is C233 A? ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG A. Silent +---------+---------+---------+---------+200 151 --------B. Minor missense (~similar properties) TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCC 0 10 C. Major missense (very different properties) a: METValHisLeuThrProGluGluLysSerALAValThrAlaLeuTrpGly D. Frame-shift b: TrpCysThrEndLeuLeuArgArgSerLeuProLeuLeuProCysGlyAlac: GlyAlaProAspSerEndGlyGluValCysArgTyrCysProValGly E. Major, non-frameshift, change in many amino acids a: b: c: CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTAT 201 ---------+---------+---------+---------+---------+250 GTTCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCAACCATA 20 30 LysValAsnVALAspGluValGlyGlyGluAlaLeuGlyARGLeuValSerArgEndThrTrpMetLysLeuValValArgProTrpAlaGlyTrpTyr GlnGlyGluArgGlyEndSerTrpTrpEndGlyProGlyGlnValGlyIle TGTAAACGAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGG a: iClicker Question 3: IleCysPheEndHisAsnCysValHisEndGlnProGlnThrAspThr b: ThrPheAlaSerAspThrThrValPheThrSerAsnLeuLysGlnThrPro c: HisLeuLeuLeuThrGlnLeuCysSerLeuAlaThrSerAsnArgHisHis- Hemoglobin Nagasaki is caused by the mutation A202G. What kind of mutation is A202 G? ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG A.51 Silent +---------+---------+---------+---------+200 1 --------B. Minor missense (~similar pr...
View Full Document

This note was uploaded on 03/28/2014 for the course BIO 111 taught by Professor White during the Fall '11 term at University of Massachusetts Boston.

Ask a homework question - tutors are online