10:9 Proteins and Nucleic Acids

Leu leu p leu amp the enzyme catalyzes the conversion

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: in gene DNA rRNA (1 of few possible) loading on an amino acid working copy of protein recipe activated tRNA many, each translating one "word" of the recipe RNA translation ribosome facilitates interaction between one mRNA and many tRNAs protein: primary structure (1 of 1000s possible) self-assembly protein: secondary and tertiary structure (1 of 1000s possible) 11-8 Some details: Initiation complex: Some details: (a) Met Initiation complex - tRNA loaded with the amino acid methionine UAC completed mRNA molecule small ribosomal subunit 5' GGUAUCACAUGUGCCCGUCCGAAGCCCUU ACUU AUCAGCUU U AACUGGCA A A A (b) Met large ribosomal subunit UAC 5' GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UUAUCAGCUUUAACUGGCAA AA (c) 3' 3' Cys Met AC G UAC 5' GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UUAUCAGCUUUAACUGGCAA AA P-site (d) Cys GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UUAUCAGCUUUAACUGGCAA AA (e) Met GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UUAUCAGCUUUAACUGGCAA AA (f) Met UA 5' C 3' Cys UACACG 5' 3' Cys ACG GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UUAUCAGCUUUAACUGGCAA AA (g) 5' A-site Met UACACG 5' 3' Met Cys Pro ACGGGC GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UUAUCAGCUUUAACUGGCAA AA (h) Met 3' Cys Pro Se r 3' Leu Glu Ala GAA 5' CGG GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UU AUCAG CUUUAACUGGCAA AA (i) Met 5' Cys Pro Se r Glu Ala Leu Thr Gln Leu GAA Met Cys Pro Se r Glu Ala Leu Thr Tyr Gln 3' Leu G 5' release factor Tyr GGUAUCACAUGUGCCCGUCCGAAGCCCUU AC UUAUCAG CUUUAACUGGCAA AA (j) 3' A A GGU AUC AC AUGUGCCCGUCCG AAGCCCUU AC UU AU C AG CUUU AACUGGCAU UU 3' 11-9 Point mutations: A A TTGCATAGTAGG... or broken up into triplets TTG CAT AGT AGG ... TTGCATAGTAGG... or broken up into triplets TTG CAT AGT AGG ... a base substitution a base substitution G G TTGCGTAGTAGG... or broken up into triplets TTG CGT AGT AGG ... TTGCGTAGTAGG... or broken up into triplets TTG CGT AGT AGG ... same same different different same same same same Deletion mutations: T T CATTGAGGTTAGACGC... or CAT TGA GGT TAG ACG C.. ... CATTGAGGTTAGACGC... or CAT TGA GGT TAG ACG C.. ... CATTGAGGTAGACGC.... or CAT TGA GGT AGA CGC ... ... CATTGAGGTAGACGC.... or CAT TGA GGT AGA CGC ... ... different different same same different same same same different same A A CATTGAGGTTAGACGC... or CAT TGA GGT TAG ACG C.. ... CATTGAGGTTAGACGC... or CAT TGA GGT TAG ACG C.. ... CTTGAGGTTAGACGC.... or CTT GAG GTT AGA CGC ... ... CTTGAGGTTAGACGC.... or CTT GAG GTT AGA CGC ... ... different different different different different different different different different different Check your understanding: 1. Write a flow chart for each of the following processes: DNA replication, DNA transcription, and RNA translation. Label each character in the story and be able to describe what is occuring in each step. 2. How are all of the above processes connected? 3. What process is involved in making tRNA and rRNA? 4. When is DNA replicated? When is it transcribed? When is RNA translated? 11-10...
View Full Document

This document was uploaded on 03/27/2014.

Ask a homework question - tutors are online