320 answer key_midterm 1

320 answer key_midterm 1 - Last Name F48 First Name Lab(day...

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 6
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Last Name: F48 , First Name: Lab (day and time): , TAs: B130 320 Midterm 1 Se tcmher 24 200'? Please pin-n your last and first name on very page. (1 pt deduction for each violation) Answers written in pencil are NOT eligible for re—grade. l) {3 pts} which of the following is a covalent bond? a) hydrogen bond h) ionic bond c hydrophobic bond @ a isulfi de bond 2) (3 pts) Isoelectric focusing separates proteins based on their: a charge to mass ratio net charge c mass d) shape 3) [6 pts) Predict the results of the Messelson—Stahl experiment if DNA replication occurs through a conservative mechanism. Give the 9/0 of each of the three DNA classes at: l) the beginning of the experiment (after growth in the heavy isotope medium), 2) after one round of DNA replication, and 3} after two rounds ofDNA replication. I) «(47-63% {if—H “‘3 "If" Wells‘s correct.- hut WW Wbfld arrivi- 1mm) 2) +3, embh 1-? can’t-:0th 5'6’A 1.3L HA: w wrung bul- qu ICC)?“ g) 252F144 m beflsunwg +l 75% H 4) (6 pts.) Define primary, secondary (you may give examples), and tertiary levels of'prolein structure and exglaiu the 'or c ' (or interaction} that stabilizes each level of Emma “11 ll; |15+¢ lefiflt bards t lu' a’fufrflfl' (J ((-62. 9“” N f7} C” Mm’flbfil+l ML,“ fiy'fkv by (Wei/Art gar [El-(M N and «20’ Pfi'ulsr firefly-ssh“ as into g'VMC'lZL-fl’f'l'l 59.5% as at-l‘C-“lvx cJ [3~-$1~ec-l,4=‘42~?;.lfzefl b; H' '3“w 3H9 mama‘s Ya'wwh‘vfi: ‘F‘W Males 6°C 2" warms (In un$"l~f¢-¢Cl~flr?/ raga”; as lash-sea 7 be hyolrophobn‘ttl warm has .7" pp» c,‘ lAlLT “nu-Llumvc an.” .- Page 2 5} (3 pts) Which of the following DNA sequences is most likely to be found in the genome of an organism with 60% GC content? a) AATTAATT GGCCGGCC GGCCC b and c are equally likely 6) [3 pts) The proofi'eading function of DNA polymerases is: a 5' to 3’ exonuclease $1? to 5‘ exonuclease c 5’ to 3’ code-nuclease d) 3’ to 5’ endonuclease 7) {4 pts.) Describe a plasmid vector: Name its required elements and briefly describe its main puzpose {for researchers). I) ('fl‘j'ln Le-l (@Fiiral4em _ 31) {no Hip LQ_)--(lenipj {rid-P é.sl,fl.c+,-m $-25 mi l by, an»: J one; 3) seleclz H9 (rs-ffij Or gamete a one“: hon-avg— U’Sc'Q-l‘ +29 fraiafe 6:3 .éLl‘C'flE.H(‘-E(65M)C§M. Praaietéfl m 8) {7* pts.) Invent u resuiction endonuelease that recognizes a specific 8—base pair sequence, which is 75% AT-nch and cleaves the DNA leaving 5’ overhanging ends. 9s) Write out your invented recognition sequence, showing both strands (use line ‘1 and write in bases). 1’ : if . If If tini- l ale-sled. I13. 54 - éT A C T 3 cum“ I r' ;‘ [WINNING ; l - --* v I "Hull-Inn 5 yHfiHTACATéTA as; *Mfia TE) 0/0 AT rr'LL‘flQ I If“) frfluchCiQJ" it“; ‘3 ‘05 ‘1 13) Use arrows on sequence above to indicate ites of endonuclease cleavage N" U‘i“ W”: 5' ONE-t “0‘35— PolludLo-rw'c. :3ch Draw out the DNA sequences utter cleavage and separation [denaturatiofl 0 ends mUSd D; jljfiv Stpcvo'ilon loosed 3.. Lm Fla dad-d2 . I '5 ' ———— AT'g 51mm Arr 3” gu—flwrecesee' TA 5 '5 IOtcrt-aenqe'? "-‘I' [90% clLDf'i'Ic? (D (INCL—Ill 1r.- cne." -.:v. M circT'w'n if d) To produce large quantifies of this enzyme for commercial purposes fie, making lots l of money), you would like to express this enzyme in E. can for purification. Which additional enzyme would you need to invent and express in your E. coil fiIst'? -'. Io (Luml'vF l'Jl'Ib-J'a l WR, L5H 'l'Fc'i‘ modifies? 52'th g‘pftraod Page 3 9) (3 pts} With respect to DNA topology, DNA replication causes: a) positive supercoiling ahead of the replication fork 13} DNA unwinding atl'behind the replication fork catenation of DNA ahead of the replication fork @all of the above 10) (3 pie} Denaturaiion of a protein typically results in a change in its: i a) primaryr structure 13 phosPhorylation state @teifiary structure mass + I ll) {6 pts.) Draw a replication fork in the process ofDNA replication. Show at least pig" UkaZE-ki fiagfifltfi indicating which one came first, leading and la ging strand templates, and i. strand orientation:I Distinguish RNA fi'om DNA. Do not show or descrIEe protein activities. ' Use line form to draw the DNA; do not‘aliow bases. mm 12) {8 1115.) Compare and contrast the activities of Topoisorneraae I and I] {Topo I and Topo II) explaining two similarities and two differences (one hint: how do they affect the Jinjg'ng number?) It?" a 4-9“ =- S‘I'n-‘ndrii-t'f 2 i) 50%;“ (“‘4— g'?’ (if; V'I'ri ' Dflfi @- Z) (En-find ('Jffir05+{lr A‘Hzcerl +0 bum use fire-sing (fl-lmhrie iijgfisrv‘! owi- 0N4 bow. We. L5) I’d-h“ Chg”)! $4."? Uniting nun-£91!” height 5‘?“ - 1: , m In“ . 5 (elm! 5af€rrai In?) ’. “ I {Lemma 5, ism m- m we mums.» ahead c-F' fork. QWLQ} ‘_ Taco: (Ii/He's {‘der-J (fyhgg. IQCI‘LWJ L; "Err If dflfflmwfl'i‘f'f IFS!de- (Létylf Lg by I "for: H. (Llfiv/Vs L} by 2 fl; 'chal reissue; only ‘3 {ad‘th Mfcwnism 'ln Jf‘i-uii ‘4! “Tags: II um Iii—Ti) Page 4. 13} (3 1315] Which of the following polypeptides regions is most liker to bind DNA non— specifically: a) a region will] many hydrophobic amino acids é a region with many polar amino acids r‘\. 5371:, a region with many basic amino acids 3 region with many acidic amino acids 6,: G for the reaction equals zero ) the ccncenh'alion of products equals the concentration of reactants c) a catalyst no longer accelerates either the forward or rover-5e reaction d) all of the statements are true 14} [3 its: For any reaction at equilibrium (KW): l5} (3 pie...) Give the cocci-fie biochemical function of four major classes of protein activities a? as accesses cassava his. a a c: a a a 1-?th QOf‘fl-Frfifsv; (247' :35 pflil‘l‘cm 5 My.) AMP: [-1111]; 9N9 a4 qr [mar-a alley»?le jam; ho”:— DNPr Heleas: ' fli'zlyqer PH.er '- Rl‘m' tuba-4414:“ ‘H-n'f an'H‘an‘ A? new may 5-; DNA W - DNA of,“ : (“a-hlywr {mama AM (ii eh?“ i“ élic‘ii“) Clearly: Tfli‘alojlrrciltf' {Elia Fairway li- ‘kflfl‘k _ infrfl‘srfi premarva 95g: Heir? rte/Twain} DNA m 55‘ {arm DMH Fc’lymflrss-l. £6) (4: pts.) Draw a single stranded DNA molecule {in line form with leners for bases) with a simple secondary sanctum (your ch ice E‘f‘Qpe). Show hydrogen bonds as dotted lines ’ l \ . but“; 5- c.’ @_ d“. M (ii -/ F——— neéJ 51+ lfasi 2 ‘ l f bard“); En Hint-pin Niall Viv-slaliwa “pk‘éfiki '(rfijMfl'l‘ W 64¢an Dusgt‘xmm'i‘“ 34M ' Page 5 17) (3 pts) Which of the following double—stranded DNA~ molecules has the highest denaturation temperature {Tut} (Only the sequence of one strand is described below, assume the 2nd strand is perfectly complementary to the first and that all the molecules are the same length)? a an alternating series of A and T r an alternating series of' G and C a sequence with equal amounts ofA. T, C, and G d) they all have the same Tm 18) (3 pts} Which of the following protein structures may be involved in DNA binding: globular domain @elix—twnhelix c trimeric structure d} allofthe above 19) {3 pts} Which of the following statements regarding double stranded DNA structure is not always Irue':J a) The molar concentration of A+G = C+T b Themolar concentration of A=T and G=C e molar concentration ofA+T = G+C None, all the statements are always true. 20) (6 me) How does atypical sequence-specific DNA binding protein “rea " the sequence of Q DNA? Describe the main stnicttnal features and chemical gouge of the protein and DNA ‘ invogd, and the main e of chemical interac ' involved. end-affi- - .__ I H_I__ F- a a r WWW firm/[fl Ham-’50 _‘ I _ 6 Lotus ffd'fi'r“ ffiur‘lwqr {yoga n: 0G A?“ 163.51 bib- “ h in r {Pia-I tin-Mc‘gm. { I. b . a {D y f 3 0 r Fair? Pr alel‘l‘ 21) (4 QB. extra credit) Give the sequences of oligonucleotide primers 3 bases in length that can be used to PCR amplify the following DNA in its entirety (only one strand of the double- stranded template is shown). 5 ‘ -CAGTGACATAAGATCTTCGAGACCCTTAGCTACCCATTGGGCTTAGGTC—S ’ .) 5’. ('eé'téACA—B' 2) emanates 6:5’ rage I: r 22, {6 pts} Draw the structure of a G-C‘ base-pair. Make sure to name each base (full name]?‘% Show H~bonds as dotted lines. Show which atoms isr‘are attached to deoxyribOSe in DNA 5); drawing a bond to “dR”. “rich”; "°”"w=H*"N'H I y . wrist/L N _,.p-.:a,_‘ / ix g. t. /\ tlr 1 l 0 ‘1’ Gonner (Yr-3136!“? 23. (6 pts.) Mendel began his experiments with strains of pea plants that bred true (inbred) for one of seven different characteristics. ’3 Q5 a) beginning with an inbred strain that produced white flowers and round seeds and a second inbred strain that produced purple flowers and wrinkled seeds, what phenotypes are observed in the F1 plants and in what proportions? Ill—cg: round seeds {R} and purple flowers (P) are dominant; also, for parts (a) and (b), assume the genes are unlinked. (0:7? Rafts '9ve + [2an 3820’? 39:5 b) after allowing the F1 plants to self-pollinnte, what phenotypes are observed in the F2 generation and in what propomons'? a}: g : 3 '. I "fir Punt: [laws 3* when 9&4 /3 ‘ Ufir‘m’ .- I, mm urmttm e] :4 pts. extra credit] What would the results be in the F2- generation if the gene for Purple flowers is very tightly linked to the gene for Round seeds {assume no reeernbination between them}? ' : Curie flu,” F )222l | Extra Ii {Ar may“ gar-J +0 be all “flat I PL»?pr Wrmkbd \I: rm Farm] of It ...
View Full Document

{[ snackBarMessage ]}

Page1 / 6

320 answer key_midterm 1 - Last Name F48 First Name Lab(day...

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online