bio lab 2 bacterial identification lab

This is done by denaturing these enzymes in 100 c

This preview shows 1 out of 3 pages.

new enzymes can be used. This is done by denaturing these enzymes in 100 C water bath. Then the debris are separated by using centrifugation. This will then form a pellet at the bottom the DNA is then contained within the liquid. Also the molecular biology lab involved an in vivo technique rather than the in vito technique used in this lab. The difference between the two is that in vivo involves manipulating the component within the living organism, whereas in vito involves manipulating the component outside of the organism (articifical environment) such as in a test tube. 5) Located at the end 6) Both the negative and positive controls contain the PCR master mix solution. However, only the positive control reaction should show a PCR product. 7) If the positive control did not produce a PCR product then one can conclude that an error was made when making this solution. The error most likely occurred within the procedure. For instance perhaps the temperature for each step was not correct, or that the timing of how long the solution should remain in each step was off. For instance during the first step “melt” it could be possible that the DNA did not separate from one another. There could also be a problem in the PCR master mix such as a better buffer could have been chosen. Also the quality of the DNA could be poor or the primer couldn’t fit. 8) The target sequence DNA is the following: 5’ AATTGATCGTCGATCCAATGGA 3’ 3’ GTACACCTTTAACTAGCAGCTA 5’ This is the answer because these are the sequences of DNA which occurs between the two primers. Thus they overlap.
Image of page 1

Subscribe to view the full document.

9) In PCR the DNA is separated during the first (melt) step. This is done by heating the vial at 95 C for about 30 seconds. Then the vial is cooled so DNA can properly bind to the primer. The
Image of page 2
Image of page 3
You've reached the end of this preview.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern