BIO
Obermiller Bio 340 Problem Set 1 2018 (1)print.docx

1 obermiller bio340 summer a 2018 problem set 1 b

Info icon This preview shows pages 1–4. Sign up to view the full content.

1
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Obermiller - Bio340 - Summer A, 2018 - Problem Set #1 b. What is the basis for your choice? 3) The following DNA sequence is the hypothetical coding strand for the botulism toxin protein produced by Clostridium botulinum , the most acutely toxic substance known on earth with a human median lethal dose of ~1/10,000,000 of a gram when injected and about 10 times that amount when inhaled. It derives this lethality by blocking signals between nerves and muscles, sometimes for up to several weeks, also causing paralysis of the muscles that control breathing. However, diluted levels of this toxin can be injected into muscles of the face causing paralysis and reducing wrinkles. Other clinical uses include treating muscle conditions associated with cerebral palsy , multiple sclerosis , stroke and Parkinson's. You want to artificially engineer this protein in the lab for patients (which is much safer than growing C. botulinum ), but all you have is the one strand of the DNA sequence for it, shown below. CATCAGGAGGTTTGATCCTATGGCTGGGAATCGGGACTAAAATTCGGGC a. Write out the template strand directly above the coding strand. b. Write out the mRNA sequence below the non-template strand. c. Underline the start and stop codons of the mRNA. d. Indicate the 5’ and 3’ ends of each DNA strand and the mRNA e. Draw a box around the open reading frame of the mRNA. f. Double-underline the Shine-Dalgarno sequence in the mRNA. 2
Image of page 2
Obermiller - Bio340 - Summer A, 2018 - Problem Set #1 g. Write out the amino acid sequence of the polypeptide encoded by this sequence. Indicate the amino and carboxyl termini of the polypeptide. 4) Consider the following diagram of a replication fork. It shows only the template strands, not the newly synthesized strands. The 3’ end of one strand is labeled. a. Draw an arrow to show the direction in which replication is proceeding. b. Is discontinuous replication occurring on the upper or the lower strand?
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 4
This is the end of the preview. Sign up to access the rest of the document.
  • Winter '15
  • MarcoMangone
  • DNA

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern