b Detection of vanA and van B gene by PCR Oligonucleotide primers for van A van

B detection of vana and van b gene by pcr

This preview shows page 5 - 9 out of 17 pages.

b) Detection of vanA and van B gene by PCR: Oligonucleotide primers for van A ( van A F5' ATGAATAGAATAAAAGTTGC 3' and van A R5' TCACCCCTTT AACGCTAATA3') and van B ( van B F5' GTGACAAACCG GAG GCGAGGA 3' and vanB R 5' CCGCCATCCTCCTGCAAAAAA 3') genes were selected according to Saha et al. 2008 and Tiwari and Sen 2006 [29, 47]. Clinical isolates that was suspected to be VRSA, by MIC, MBC, DAD and vancomycin screening agar test; was used for this study. The PCR amplification mixture contained 1X Phusion GC buffer containing 1.5 mM MgCl 2 , 200 μM dNTP, 2 μM each primer, 0.1 μg template DNA, 3% (v/v) DMSO and 1 U Phusion DNA polymerase. The amplification conditions were initial denaturation at 98°C for 2 min, followed by 35 cycles of denaturation at 98°C for 10 s; annealing at 50°C for 1 min; polymerization at 72°C for 1 min 30 s for vanA gene and initial denaturation at 94°C for 10 min; 30 cycles with a 30 s denaturation step at 94°C, a 45 s annealing step at 50°C and a 30 s extension step at 72°C and 10 min extension step at 72°C and a holding step at 4°C for vanB gene. The PCR products were mixed with 2 μ l bromophenol blue, electrophoresed in 1.2% agarose gel with 0.1% ETBR and visualized by using UV transillumination.
Image of page 5
Al Ameen J Med Sci; Volume 4, No.2, 2011 Chakraborty SP et al © 2011. Al Ameen Charitable Fund Trust, Bangalore 157 Results Species identification: The clinical isolates were identified using standard biochemical tests. Purification of bacterial culture by a single colony isolation technique on NA containing 10% sodium chloride exhibited several types of colony. Table 1 illustrates, 73.17% isolates were Gram positive and 26.83% isolates were Gram negative; 100% of gram positive isolates are oxidase positive, catalase positive and coagulase positive; all isolates were non-motile and gave positivity in latex agglutination test; 100% of gram positive isolates had thermonuclease activity, mannitol fermentation activity, haemolytic activity ( α haemolysis-45% and β haemolysis-55%) and were susceptible to lysostaphin. PCR amplification of the nuc gene of isolates using the gene-specific primers and the genomic DNA preparation yielded a 230 bp amplicon (Fig. 1). Table-1: Results of standard biochemical tests of clinical isolates, collected from pus sample of patient. ND=Tests are not done, + ve = tests are positive, -ve = tests are negative.
Image of page 6
Al Ameen J Med Sci; Volume 4, No.2, 2011 Chakraborty SP et al © 2011. Al Ameen Charitable Fund Trust, Bangalore 158 Figure-1: Agarose gel electrophoresis of PCR-amplified nuc genes of clinical isolates (a) Lane 1: 100 bp ladder; 2: S. aureus ATCC 25923, as positive control; 3-22: twenty clinical isolates. (b) Lane 1: 100 bp ladder; 2: S. aureus ATCC 25923, as positive control; 3-12: ten clinical isolates.
Image of page 7
Al Ameen J Med Sci; Volume 4, No.2, 2011 Chakraborty SP et al © 2011. Al Ameen Charitable Fund Trust, Bangalore 159 Antibiotic susceptibility testin g: MIC of antibiotics: The MIC values of penicillin G, ampicillin, cephotaxime, gentamycin, streptomycin, tetracycline, erythromycin, chloramphenicol, norfloxacin, methicillin and vancomycin for isolates were determined. In each set of experiment, bacterial control tubes showed no growth inhibitory effect of antibiotics. These MIC
Image of page 8
Image of page 9

You've reached the end of your free preview.

Want to read all 17 pages?

  • Fall '13
  • Omair Gul
  • Staphylococcus aureus, Vancomycin, Methicillin-resistant Staphylococcus aureus, Ameen Charitable Fund, Ameen J Med Sci

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture