31 explain two ways genetic variation is increased

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
31. Explain two ways genetic variation is increased during the process of meiosis. 32. Meiosis creates non-identical gametes, why is that important? 33. Describe the differences between mitosis and meiosis.
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
DNA 1. Transcribe and translate a DNA strand (mRNA, tRNA, Amino Acid Sequence) and determine the effects of a mutation. 2. Describe who determined the structure of DNA. 3. What is the monomer unit of DNA and RNA? 4. What are the components of a DNA and a RNA nucleotide? 5. State the base pairing rule for DNA 6. State the base pairing rule for RNA 7. How many hydrogen bonds are between the nitrogen base pairs? 8. What bond connects phosphate and sugar molecules together? 9. What are genes composed of, where are they found, and what is their function 10. What is the difference between genotype and phenotype? How are they related? 11. Compare and Contrast DNA and RNA 12. Below you will find a strand of DNA, what is the complementary DNA strand? ATCGGA 13. Determine the corresponding mRNA, tRNA, and amino acid sequences based upon the following DNA sequence: GCCTACGGAGCTCGGACTTTGTAGAAA 14. What is the function and location of the ribosome? 15. Describe what genes code for 16. State the stages of Protein Synthesis 17. Explain Transcription 18. Explain Translation 19. Explain tRNA’s role in translation (anticodon) 20. The following sequence consists of how many codons? AUGCCAUAUCGU 21. When translating a message what happens when you reach the stop codon? What about if there are still codon’s after the stop? 22. Explain the effects of mutations 23. Describe what causes mutations 24. Describe a situation when a mutation may not have an effect 25. Describe a situation when a mutation could be beneficial 26. Why are frameshift mutations usually one of the most devastating mutations? 27. Explain how the environment may influence your genes 28. Explain how cell differentiation occurs when all the different cell types of an individual have the same genes. 29. Describe the process of how you would form a transgenic organism through DNA transformation. Mendelian Genetics 1. Solve a genetics problem (possible types: monohybrid, dihybrid, incomplete dominance, codominance, sex-linked) 2. Explain Mendel’s law of segregation 3. Explain Mendel’s law of independent assortment 4. Explain why Mendel’s laws of independent assortment doesn’t apply if both genes are found on the same the same chromosome (gene linkage) 5. Contrast genotype and phenotype 6. Explain the difference between homozygous and heterozygous 7. Describe the difference between being true-breeding or hybrid for a given trait 8. Explain the difference between dominant and recessive alleles 9.
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern