The ssrps has heralded the final chapter in the quest

Info icon This preview shows pages 591–593. Sign up to view the full content.

View Full Document Right Arrow Icon
the SSRPs has heralded the final chapter in the quest for the mo- lecular mechanism of cisplatin or merely been an entertaining sidelight. e. Drug Resistance: What Do We Know? 150 Perhaps the most serious problem for successful chemotherapy of tumors is drug resistance. 102 In most tumors there exists a subpopulation of cells that are naturally resistant to a given drug; as the sensitive cells are these refractory clones take over. In ad- dition, resistance can be acquired by tumor cells following repeated apl)lJ(~at]lon of the drug. Attempts to identify mechanisms responsible for cisplatin resistance have therefore been the subjects of considerable research activity. Other DNA- damaging agents sometimes genes as a mechanism of drug resistance. An example is the resistance phenomenon, in which a gene encoded for a P-glycoprotein is amplified in cells resistant to agents such as daunomycin. This protein is believed to increase efflux of the drug through the cell membrane by an ATP-dependent, energy-driven pump. There is currently an intensive search underway to see whether the cisplatin resistance phenomenon has a genetic ori- gin. If a cisplatin resistance gene could be cloned and its phenotype identified, a powerful new avenue would be opened to overcome drug resistance. 8. Site-specifically platinated 154 a. The Problem Much of the information obtained about the mechanism of action of cisplatin has been derived from experiments where Pt-DNA binding has occurred in vivo or in vitro, with the use of random-sequence DNA having all available targets for the drug. In these studies, platination is controlled by the inorganic chemistry of cis-DDP in the medium and the accessibility of target sites on the DNA, as already discussed in considerable detail. As such, this situation best represents drug action as it actually occurs in the tumor cell. On the other the resultant spectrum of DNA adducts makes it if not imlpm;sit)!e, to the structural and functional consequences of any spe- cific adduct. In order to address this problem, a methodology has been devel- oped in which a single adduct is built into a unique position in the genome. This approach is powerful and has the potential to be extended to the study of many other metal-based drugs. In this section, we discuss the strategy used to construct such site-specifically platinated DNA molecules and the infor- mation obtained far from their study. Some uses have already been dis- cussed.
Image of page 591

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
574 (+) AGAAGGCCTAGA (-) or (+) (-) !CT~~~T(::.- .- ..... 0" ~ ~ (+) GGATCCTCTAGAGTCGACCTGCAGGCATGC (-) ~CT AGGAGATCT~AGCTG.l;ACGTCCGTACG, .Bam I'll Xba I Hinc II PlOt I Sph ~, " Cia I Figure 9,29 Map of the genome crcated by insertion of cis-DDP platinated or unplatinated d(TpCpTpApGpGpCpCpTpTpCpT)-d(ApGpApApGpGpCpCpTpApGpA) into the Hinc II restriction site of bacteriophage M13mp18 DNA.
Image of page 592
Image of page 593
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern