O what blast algorithm did you use smartblast

  • No School
  • AA 1
  • 16

This preview shows page 4 - 10 out of 16 pages.

If there is a pattern gather at least 10 similar sequences that also contain this pattern. o What Blast algorithm did you use ? smartblast Generate a multiple sequence alignment(MSA) and paste it below: o From the MSA you created analyze your alignment and give a brief description of the following. Physiochemical characteristicsthere are numerous hydrophobic identity Identity: Occupancy : it started at 8 , later 7 and goes to 9, then high occupancy , 10, started from 185 to 1480 Conservation it is high conservative of 185 to 1480 Name 4 autosomal dominant diseases that are caused by a mutation in this gene: 4 BTEC4300/6304 Exam 1
Image of page 4

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 2.With the protein you found in question 1 find the following (10 points): ( HINT: You will have to get the full FASTA sequence for this protein if you just use the partial sequence from question 1 you will get this question wrong ) 5 BTEC4300/6304 Exam 1
Image of page 5
UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology GC content: Molecular Weight:141785.38 Theoretical PI:6.58 6 BTEC4300/6304 Exam 1
Image of page 6

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology Which amino acid appears o The most?Glu o The least? Instability Index: o Is this protein Stable? Aliphatic Index: GRAVY: o What does it stand for? o Is this protein hydrophobic or hydrophilic? Hydrphobic 7 BTEC4300/6304 Exam 1
Image of page 7
UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 8 BTEC4300/6304 Exam 1
Image of page 8

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 3. Find the open reading frames in the sequence below(10 points). (HINT: There are 3 open reading frames that encode for different proteins) 9 BTEC4300/6304 Exam 1 ATGTATTTTGCTTGAATATTATTTGCCTTGCTCAAAATTAAATAAATTGGCTTTTCTTTCACTCAATTGA AGCTTCATATAATTATATTATTGTCTGAAGCCAGAACTCACATGAGTGGTGTTTCTCTATTCTTGGGGAA AAGTGTTCTTCTATTTGAAAGTGTTAGAGCTACTAAGTGAAGAACTAATCTATCCCAGGTATAGGCCACG ACAGTTGGCGCCCAACGTGGGGCTCGATTGAGTGAAATTTAAATTAAGCTGAGGAGAATAATCCCTAGGG ACCTTACCTTACTGAGGAAGGATGGCTCGAGAATTAAATCCTCTCCAATTACAGCAACTGTATATAAATA ATGGCTTACAACCTAATCCAGGACATGGAGATATTATTGCTGTCAGATTTACAGGAGGACCTTGGGGTCC AGGTGATAGATGGGCTAGAGTGACAATACGATTACAAGATAACACAGGACAACCTTTACAGGTTCCTGGA TATGATTTGGAACCTGGGATAATAAATTTGAGAGAGGATATCTTGATAGCAGGGCCATATAATTTAATAA GAACTGCCTTTTTGGACTTAGAGCCTGCCAGAGGACCTGAAAGGCATGGTCCCTTTGGAGATGGCAGATT ACAGCCTGGAGATGGTTTATCTGAAGGATTTCAACCTATCACTGATGAAGAAATACAAGCAGAAGTAGGA ACTATTGGTGCTGCTAGAAATGAGATAAGATTATTACGAGAAGCTTTACAGAGATTACAAGCTGGAGGTG TGGGTAGACCTATACCAGGAGCAGTTTTACAACCACAACCAGTAATAGGGCCGGTAATACCAATTAATCA TCTTAGGTCGGTTATTGGCAATACTCCACCAAATCCACGAGATGTCGCCCTATGGCTTGGAAGATCTACA GCCGCTATTGAAGGAGTATTTCCCATAGTGGACCAAGTCACTCGTATGAGGGTAGTTAATGCCTTAGTAG CATCTCATCCCGGCCTAACGTTGACTGAGAATGAGGCCGGGAGCTGGAATGCTGCCATATCAGCTTTATG GAGGAAAGCTCACGGTGCTGCAGCTCAGCATGAATTGGCAGGAGTATTAAGTGATATTAATAAAAAGGAA
Image of page 9
Image of page 10
  • Fall '19
  • DNA, Department of Biotechnology

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern

Ask Expert Tutors You can ask 0 bonus questions You can ask 0 questions (0 expire soon) You can ask 0 questions (will expire )
Answers in as fast as 15 minutes