Put the following steps of Rho independent transcription termination in order

Put the following steps of rho independent

This preview shows page 9 - 13 out of 36 pages.

Put the following steps of Rho-independent transcription termination in order:nverted repeat DNA sequences are transcribed weak hydrogen bonding between the RNA and DNA at the six adenine sequence allows to RNA polymerase to fall off the DNA. equence of six adenines are transcribed while the RNA molecule folds into a hairpin structure intRho-dependent and Rho-independent are two mechanisms for the termination of transcription in prokaryotes. Which of the following is NOT a component of Rho-independent termination? Select all that apply. The rho utilization sequence on transcribed RNAInverted repeats within the DNA sequenceThe protein factor RhoThe formation of a hairpin structure Quiz 7: Polarity 0 / 1 pointGiven the following double DNA sequence representing a typical E.coli promoter region, label the polarity of each strand. Number only.
Image of page 9
________ (3) ACGATTGTAACTGTTGATCGTAACTGCTACATATTATGAGATCCAT ________ (5) ________ (5) TGCTAACATTGACAACTAGCATTGACGATGTATAATACTCTAGGTA ________ (3) 0 / 1 point Given the two complementary DNA sequences below from an E.coli gene promoter region, match the following labels to the appropriate strand. TGACAACTACGCATTGACGATGTATAATACTTCTACGG ACTGTTGATGCGTAACTGCTACATATTATGAAGATGCC 1 . Template 2 . Non-template 0 / 1 point What would be the first 3 nucleotides in the RNA sequence that would be transcribed from thefollowing E.coli DNA sequence? NOTE: Use the appropriate letter to designate each nucleotide. Donot include spaces in your answer. ________(AUU)5’-TGCACATTGACAATTAGATCATGTCGATGTATAATCACTCTATTA-3’3’-ACGTGTAACTGTTAATCTAGTACAGCTACATATTAGTGAGATAAT-5’The E.coli RNA polymerase holoenzyme consists of 5 components, which of the following components confers the site specificity for the initiation of transcription?
Image of page 10
Question 2 0 / 1 point Which of the following is NOT a eukaryotic promoter sequence? (All are written 5' to 3') Question 30 / 1 pointThe ribonucleoprotein structures which function in nuclear pre-RNA splicing are called: Question 4 0 / 1 point In prokaryotes transcription, translation and RNA degradation often occur simultaneously. TrueFalse Question 50 / 1 pointWhich of the following is NOT an example of the RNA processing that occurs in eukaryotes?
Image of page 11
Image of page 12
Image of page 13

You've reached the end of your free preview.

Want to read all 36 pages?

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture