The spliceosome is a large ribonucleoprotein complex located in the A cytoplasm

The spliceosome is a large ribonucleoprotein complex

This preview shows page 6 - 8 out of 10 pages.

28. The spliceosome is a large, ribonucleoprotein complex located in the:A) cytoplasm.B) endoplasmic reticulum.C) Golgi aparatus.D) nucleus.E) nucleolus.29. Which of the following spliceosomal components specifically recognizes and binds to the branch point of the intron during pre-mRNA splicing?30. Which of the following is found in the primary product of transcription but not in a mature mRNA molecule?31. The 5ʹcap on an mRNA is important for all the processes listed below except for the _____ of an mRNA molecule.32. The sequence below represents a pre-mRNA. What would happen if the G in the 5' splice site were mutated to a C?mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it.B) The spliceosome complex would be degraded because it could no longer recognize the 5' splice site.C) The U1 snRNA would not be able to bind complementarily to the 5' splice site.D) Splicing would still occur appropriately because the G is not essential at the 5' splice site.E) The 5' cap would not be able to be added because it requires the 5' splice site to be functional.
Background image
33. siRNAs and miRNAs function in which of the following processes?34. For any sequence of nucleotides, how many reading frames are possible?D) 5E) 1035. Scientists once believed that each gene can encode a single polypeptide. We now know that _____ and _____ allow a single gene to encode more than one polypeptide.A) transcription; translationB) polyadenylation; RNA transportC) DNA methylation; chromatin condensationD) alternative processing; RNA editingE) gene silencing; RNA interference36. Which of the following statements about ribosomes and ribosomal RNA is NOT true?
Background image
Image of page 8

You've reached the end of your free preview.

Want to read all 10 pages?

  • Fall '19
  • DNA

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture