Smn down regulation the smn specific sequence sirna

Info icon This preview shows pages 3–4. Sign up to view the full content.

SMN Down-Regulation The SMN -specific sequence siRNA duplex was designed using Invitrogen software. The siRNAs were synthesized targeting bases 142-163 by Invitrogen (Carlsbad, CA): Sense SMN siRNA 5'GACCUGUGAAGUAGCUAAUAGUACA3', antisense SMN siRNA 5'UGUACUAUU- AGCUACUUCACAGGUC3', sense control siRNA 5 ' G A C A G U G A U G A A U C G G - AUAUUCACA3', antisense control siRNA 5'UGUGAAUAUCCGAUUCAUCACUGUC3' (Trulzsch et al. , 2004). The SMN specific siRNA sequence was BLASTed (NCBI database) and a control siRNA sequence used to support the conten- tion that only the SMN gene was targeted. Furthermore, a subset of these experiments were repeated using siRNA targeted to a different region of the SMN mRNA: Sense SMN siRNA: 5'GACCUGUGAAGUAGCUAAUAGUACA3', antisense SMN siRNA: 5'UGUACUA- UUAGCUACUUCACAGGUC3', resulting in sim- ilar SMN RNA and protein knockdown and injury assay results (not shown). Quantitative RT-PCR Total RNA from transfected cells was extracted using RNeasy Mini Kit (QIAGEN) following the manufacturer's protocol. Total RNA (4 µ g) was used to synthesis cDNA 40 µ l using Taq-Man reverse transcription reagents (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The reactions were incubated at 25ºC for 10 min, 48ºC for 30 min, 95ºC for 5 min and soaked at 4ºC. Quantitative real-time PCR for the SMN gene and internal control β -actin were carried out using an MJ DNA Engine Opticon System (MJ Research Inc., Waltham, MA). PCR reactions in 25 µ l volumes were performed with SYBR Green I dye (Applied Biosystems), 300 nM primers and 200 ng cDNA. The primer sequences were: mouse SMN forward 5'TGCTGTTTGGTCAGAAGACG3' and reverse 5'TACTTCACAGGTCGGGGAAA3'; β -actin forward 5'CCA-CACTGTGCCCATCTACG3' and reverse 5'AGGATCTTCATGAGGTAGTCAGTC- AG3'. The thermal cycling conditions are 50ºC for 2 min, 95ºC for 10 min, 40 cycles at 95ºC for 15 sec and 60ºC for 1 min. Experiments were performed in duplicate for each data point. Relative gene expres- sion was calculated using the comparative Ct method (Applied Biosystems, relative quantitation of gene expression user bulletin #2). Quantitative normalization of cDNA in each sample was per- formed using expression of β -actin gene as an inter- nal control. Same time point non-transfected cell samples were used as a calibrant. Ct = Ct( SMN ) - Ct( β -actin), ∆∆ Ct = Ct(siRNA) - Ct (non-silenc- ing). Relative expression was given by arithmetic formulas: 2 - ∆∆ Ct . Protein Extraction and Western Blotting Protein from NSC-34 cells was extracted with 4% sodium dodecyl sulfate (SDS), separated on 12% Tris- glycine gels, and transferred to PVDF membranes (Millipore Corporation, Bedford, MA). Membranes were incubated with mouse anti-smn IgG antibody (BD Transduction Laboratory, San Diego, CA) and an HRP goat anti-mouse IgG secondary antibody (Chemicon, Temecula, CA), visualized by chemiluminescence sub- strate (Pierce, Rockford, IL) and exposed to X-ray film.
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 4
This is the end of the preview. Sign up to access the rest of the document.
  • Spring '10
  • Bier
  • Apoptosis, Cell culture, SMN

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern