AGTGACCAGAAGAAATGACGCAGAAGTGAAATGAACTTTTTATAAGCATTCTTTTAATAAAGGAAAATTG

  • No School
  • AA 1
  • 15

This preview shows page 4 - 12 out of 15 pages.

AGTGACCAGAAGAAATGACGCAGAAGTGAAATGAACTTTTTATAAGCATTCTTTTAATAAAGGAAAATTG CTTTTGAAGTAT Sequence 2: CGTTGAGAGATCTGGTATGCTATTGTAGAACAAGAGGCTGCAAAAGAAGAGAACGCATGAATGGGACCTG CAGAAAGGGTCATTTAATGTACACGCTCTGCTGTCGCTGAACATGGAGA 4 Dr. Balan PhD Tutorial 1
Image of page 4

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 7. Given the two sequences lengths which alignment should be performed? Sequence 1: 6378bp Sequence 1: 6378bp Sequence 2: 6300bp Sequence 2: 2780bp MNILKFFFVFIVAMSLVSCSTAAPAKIPIKAIKTVGKAVGKGLRAINIASTANDVFNFLK PKKRKH 8. Given the polypeptide sequence above identify the following: - protein name - gene name - organism source - rRNA sequence 5 Dr. Balan PhD Tutorial 1
Image of page 5
UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 9. Given the multiple sequence alignment below, write the pattern for the alignment. Assume that more than 3 different amino acids in a given position means that any amino acid might be expected to occur there. NOTE: Position 12 can NEVER be A. The consensus pattern is: 6 Dr. Balan PhD Tutorial 1
Image of page 6

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 10. Given the following sequence: H-S-T-K-A-V-H-C-S-G-S-M-V-H-V-S-H-M And the following consensus pattern: [HS]-S-T-[HT]-A-X(4)-{GHV}- S-[MT]-[VHS]-H-V-[HM]-H-{M} Does the following consensus pattern properly reflect the sequence? Explain why or why not. 7 Dr. Balan PhD Tutorial 1
Image of page 7
UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology TUTORIAL 2 NOTES Reference for further reading click here: BLAST algorithms 8 Dr. Balan PhD Tutorial 1
Image of page 8

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 9 Dr. Balan PhD Tutorial 1 NOTES: NOTES: NOTES:
Image of page 9
UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 1.For the multiple sequence alignment given below: C A C A G C A A A G C G C T A C T T C C Fill in the Position Specific Scoring Matrix (PSSM): PSSM 1 2 3 4 5 A T C G Use the PSSM you created above use it to score the following two sequences GACGC and GATGA. Which of the following two sequences best matches the motif described by your PSSM? 10 Dr. Balan PhD Tutorial 1
Image of page 10

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 2. You are given the amino acid sequence of the antimicrobial peptide (AMP) Neutrophil defensin and are tasked with gathering similar sequences that have the same consensus sequence. Click the following link DEF1_HUMAN to get the FASTA sequence you will use on this question.
Image of page 11
Image of page 12

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern

Ask Expert Tutors You can ask 0 bonus questions You can ask 0 questions (0 expire soon) You can ask 0 questions (will expire )
Answers in as fast as 15 minutes