Can include morphological traits eg color structures

Info icon This preview shows pages 10–18. Sign up to view the full content.

View Full Document Right Arrow Icon
Can include: Morphological traits (e.g. color, structures) Biochemical traits (e.g. DNA, proteins) Behavioral traits A character can be any trait that varies among species and offers information about the relationship of those species
Image of page 10

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
11 Homology: similarity that results from inheritance of characters from a common ancestor Homology: similarity that results from inheritance of characters from a common ancestor
Image of page 11
12 Homology: similarity that results from inheritance of characters from a common ancestor Species 1 CATC--CCCCAAAGTCTGCAGCATGTTTTTCGGCAAGGACC Species 2 CATCAGCCCCGAAGTCTGAAGCATGTTTTTCGGCAAGGACC Species 3 CATCAGCCCCAAAGTCTGAAGCATGTTTTT----AAGGACC Species 4 CATCAGCCCCAAAGTCTGCAGCATGTTTTTCGGCAAGGACC Homology: similarity that results from inheritance of characters from a common ancestor
Image of page 12

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
13 Phylogenetics: the science of reconstructing evolutionary trees Lecture Outline 1. Tree Anatomy 2. Characters & Homology 3. Reconstructing Trees 1. Cladistic analysis 2. Homoplasy & Parsimony The logic of tree reconstruction Intuitively, we expect more closely related species to share more similarities But do all characters offer the same information?
Image of page 13
14 The logic of tree reconstruction Intuitively, we expect more closely related species to share more similarities But do all characters offer the same information? NO some homologous characters have more phylogenetic signal than others Assumptions of Cladistic Methods: 1. Taxa are related by descent from a common ancestor 2. Relationships can be reflected in a tree 3. Only shared derived traits identify monophyletic groups
Image of page 14

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
15 Synapomorphy: A shared derived character Shared: occurs in two or more taxa Non-shared: occurs only in one taxon Derived : differing from the ancestor Cladistic phylogenies are based ONLY on synapomorphies Cladistic Terminology: Cladistics: Only certain types of homologous characters are useful for inferring trees: Synapomorphies (shared derived characters)
Image of page 15
16 Cladistics: Only certain types of homologous characters are useful for inferring trees: Synapomorphies (shared derived characters) Cladistics: Only certain types of homologous characters are useful for inferring trees: Synapomorphies (shared derived characters)
Image of page 16

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
17 Synapomorphies are evidence of relationship because they define monophyletic groups How to tell if a character is derived or ancestral? The OUTGROUP COMPARISON • Choose an OUTGROUP known (on the basis of other evidence) to be OUTSIDE the group of interest • Character states present in the outgroup are assumed to be ancestral • Character states present only in the ingroup are potentially synapomorphies out ingroup
Image of page 17
Image of page 18
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern