{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

lecture5new

G dna proteins behavioral traits a character can be

Info iconThis preview shows pages 10–19. Sign up to view the full content.

View Full Document Right Arrow Icon
Biochemical traits (e.g. DNA, proteins) Behavioral traits A character can be any trait that varies among species and offers information about the relationship of those species
Background image of page 10

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
11 Homology: similarity that results from inheritance of characters from a common ancestor Homology: similarity that results from inheritance of characters from a common ancestor
Background image of page 11
12 Homology: similarity that results from inheritance of characters from a common ancestor Species 1 CATC--CCCCAAAGTCTGCAGCATGTTTTTCGGCAAGGACC Species 2 CATCAGCCCCGAAGTCTGAAGCATGTTTTTCGGCAAGGACC Species 3 CATCAGCCCCAAAGTCTGAAGCATGTTTTT----AAGGACC Species 4 CATCAGCCCCAAAGTCTGCAGCATGTTTTTCGGCAAGGACC Homology: similarity that results from inheritance of characters from a common ancestor
Background image of page 12

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
13 Phylogenetics: the science of reconstructing evolutionary trees Lecture Outline 1. Tree Anatomy 2. Characters & Homology 3. Reconstructing Trees 1. Cladistic analysis 2. The logic of tree reconstruction Intuitively, we expect more closely related species to share more similarities But do all characters offer the same information?
Background image of page 13
14 The logic of tree reconstruction Intuitively, we expect more closely related species to share more similarities But do all characters offer the same information? NO some homologous characters have more phylogenetic signal than others Assumptions of Cladistic Methods: 1. Taxa are related by descent from a common ancestor 2. Relationships can be reflected in a tree 3. Only shared derived traits identify monophyletic groups
Background image of page 14

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
15 Synapomorphy: A shared derived character Shared: occurs in two or more taxa Non-shared: occurs only in one taxon Derived : differing from the ancestor Cladistic phylogenies are based ONLY on synapomorphies Cladistic Terminology: Cladistics: Only certain types of homologous characters are useful for inferring trees: Synapomorphies (shared derived characters)
Background image of page 15
16 Cladistics: Only certain types of homologous characters are useful for inferring trees: Synapomorphies (shared derived characters) Cladistics: Only certain types of homologous characters are useful for inferring trees: Synapomorphies (shared derived characters)
Background image of page 16

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
17 Synapomorphies are evidence of relationship because they define monophyletic groups How to tell if a character is derived or ancestral? The OUTGROUP COMPARISON • Choose an OUTGROUP known (on the basis of other evidence) to be OUTSIDE the group of interest Character states present in the outgroup are assumed to be ancestral • Character states present only in the ingroup are potentially synapomorphies out ingroup
Background image of page 17
18
Background image of page 18

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 19
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page10 / 40

g DNA proteins Behavioral traits A character can be any...

This preview shows document pages 10 - 19. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online