GGTACAAATCGCCGCTACACTTACTAAAACCTATGTGTTAATGTGTAATGGGCGATGTATTACAGGTTCT

  • No School
  • AA 1
  • 5

This preview shows page 3 - 5 out of 5 pages.

GGTACAAATCGCCGCTACACTTACTAAAACCTATGTGTTAATGTGTAATGGGCGATGTATTACAGGTTCT AGAACCGACCCAGATTGTGATCCTTTGTTCTGTAAGTTGTTATGCTGGAAACAAAATATACAAGACCCTA GAGAGTGTAACCTAGAAGAATGGTGCCTGTATAGTCTTGATCCTGAACATGATCCCCTTTGGGATCCAAA AATGATTGTGCGTAGACATAGGAATCTTTTACCTTATTGTATGAGACCCTTTCTCATTTGGATGAATTAT ATTTCTCACAATCCTCTTACACAGCAATGTATTATGATGAAAACTTTGAATATGCTTTGGAGAGCACAAG CTGATGATCCAAGTGATGTTGCTTCCCTGTATCCCAGAGTCAAAGTTTTTAAGGCATCTCATTTTGACAT ATTTGGAAGTGCCTCTGGGAACAGTGAGGAGAGGGTGTCATGGGCCAAAGAGAATTCTCACAGAGGAGAA TACTCTCTGCTGCCATCTAGTGACGATGAGGAAGAAGAAATGTCAGAAAGAGAGGAATTATTGTGCCATA TAAATCAGTGTCAACAAAAGCTCTTTTATCCCGGAGGGACGACTGATGTCCTTGGAATGGAAAGCAATGT TTGGCTCACTAAATTTGTTAATATTAAATTTCCTAAAGGAACAAAAGTGATACTTCCTGATGGAAGAAAA TTCATAGCCTGTGATCCTGAGCTAAAACCATTATTGCAGGAATTGAAATTCTTGGATAGGGCAACATCTG AGTCATCTGACTCTGAATAGAAAGCCTGAATTTACCTGGATTATGCAACTTTGTCCGAGGTGGCAGAGTG GTTATGTATCTGTCATACTCGGGGAAAGTTTTGTCTTTACATGTTCAAGACATATAAAGGGTGGAAAAAT ATATTCCTGACTAAACTTCCTGGGGACTAGAGGTGTGGAAACTTTGCTGCCTCTGCTTCACGGGAAGTTT TTGGTTCGAATCCTTTTTTAGGTACTTAGTTAAGATAAGTAGTGAATAAATTACTCTCGTTCATGTATTC ATATCGAAACTATGTATCCTTTAAAACCATGTATTCTTTAGTCATCTAGATACTTAGAGTATGAAAAAAG AAACTGCAATAGTAACTATCAATGTTAGTAAATAAAGTACAGCTTAGTCATCTGATGATGTCACGAGAAA AGAACCTAGAAGAGAAGAACAACTTTCGGCATGCAACAGAGCGGGAGCTTGGTGTAGGAGCTAAGTCACC GTCTTACATCTAGAGCCTACTCTTCTTGAACTGTTCGAATCCTATTTTTGGAACTCTTACATCACCTTTA AGAGACTGAAAAGCATGACTCGTGCACAGGAAGCTCCTTTAGGGTAGAGGAAATGTTCTAATCTCCTATC TTAAAGGGTTGCTTCATTTAAGGTTCGAAACTGTGTACTGGAAGTAGATTTTGCATAACTTTAAACTTTT AGTTGCATGTTTCTGCTATTAGCAGCATATAAAAGGGTTATGGTAGATTGTACGGGAGCTCTTCTCACAG ACTTGGCTGCGTCCAGGGTGAGATTGAGACTCTCCAGCTTGGGTAAGATTTTGATATGTATTTTGCTTGA ATATTATTTGCCTTGCTCAAAATTAAATAAATTGGCTTTTCTTTCACTC The sequence has been reduced to 1pt font size for ease of copy and pasting. Click inside the text box and highlight the sequence and copy paste it
Image of page 3

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 4. Given the accession number below identify the start and stop positions of the condensation domains (10 points). Accession number: Q4WR82 Start and stop positions of the condensation domains: Function of Condensation domains: Extract the FASTA sequence of one of the domains and blast it: 4 BTEC4300/6304 Exam 1
Image of page 4
UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology PYTHON (15 points) With file z.FASTA on black board write a script for the following: - Sequence length: - Total number of: o Guanines: o Cytosine: o Adenine: o Thymine: - Calculate GC content: - Translate the file into mRNA and call it mRNATEST1.fasta - Translate mRNATEST1.fasta into proteins and name it PROTIENSTEST1.fasta - Calculate the molecular weight of PROTIENSTEST1.fasta - Perform a general BLAST search on PROTIENSTEST1.fasta o What is the protein? o What is its function? 5 BTEC4300/6304 Exam 1
Image of page 5
  • Fall '19

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern

Ask Expert Tutors You can ask 0 bonus questions You can ask 0 questions (0 expire soon) You can ask 0 questions (will expire )
Answers in as fast as 15 minutes