periods need to be stored at 4C Preserves results of the transformation Can

Periods need to be stored at 4c preserves results of

  • University of Texas
  • BIO 206L
  • Lab Report
  • MahaY
  • 15
  • 100% (3) 3 out of 3 people found this document helpful

This preview shows page 5 - 7 out of 15 pages.

periods need to be stored at 4°C Preserves results of the transformation Can mess up results (3)INDIVIDUAL: Answer the following questions regarding PCR.(a.)For the PCR sample of your genomic DNA, list the contents of the tube and describe the role of each of the components found in the PCR reactions? 1pt (b.)What would happen if Chelex beads were not used in the DNA isolation? What would happen if Chelex beads get transferred into the PRC tube? 1pt (c.)You want to amplify by PCR the entire DNA fragment (50 bp total) shown below. You have to design both forward and reverse primers that are 10 nucleotides long.5’-ACCGTTAAGG AACCGGTTTG ACTGAGATCA GTCAACCGTA GGCCTGCATC-3’3’-TGGCAATTCC TTGGCCAAAC TGACTCTAGT CAGTTGGCAT CCGGACGTAG-5’(c.i.)In the table below, write down the primer sequences with the correct directionality (5’→3’). 1 pt(c.ii.)Use an online Tm calculator (cite source) to estimate the melting temperaturesof the forward and reverse primers for this fragment. Provide the parameters listed in the table below. D1S80 is done below (). 1pt(c.iii.)Based on the typical suggestion of 1 min elongation per 1kb amplicon, estimatea minimum elongation time for the 50 bp length of this fragment? Compare this to the elongation time used in the Touchdown program. 1pt Exercise 5 Page 5 of 15
Image of page 5
EXERCISE 1 Page 6 of 15 Forward primer 5’- TGGCAATTCC - 3’ LENGTH 10 C+G% 50 Molecular weight: 3083.315 Basic Tm Degenerated nucleotides are allowed Tm: 30 °C 5’GAAAC TGGCC TCCAA ACACT GCCCG CCG 3’ LENGTH 28 C+G% 64.3 Molecular weight: 8569.455 Basic Tm Degenerated nucleotides are allowed Tm: 67.2 °C Reverse primer 5’- CTACGTCCGG – 3 LENGTH 10 C+G% 70 Molecular weight: 3084.305 Basic Tm Degenerated nucleotides are allowed Tm: 34 °C 5’GTCTTGTTGGAGATGCACGTGCCCCTTGC 3’ LENGTH 29 C+G% 58.6 Molecular weight: 8972.7 Basic Tm Degenerated nucleotides are allowed Tm: 65.7 °C (4) I NDIVIDUAL : Bioinformatics –NCBI Databases and Phylogenies
Image of page 6
Image of page 7

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture