In the segement of dna shown below you can see the

Info icon This preview shows pages 2–4. Sign up to view the full content.

View Full Document Right Arrow Icon
In the segement of DNA shown below, you can see the elements of an RFLP; a target sequence flanked by a pair of restriction sites. When this segment of DNA is cut by EcoR I, three restriction fragments are produced, but only one contains the target sequence which can be bound by the complementary probe sequence ( purple ). Let's look at two people and the segments of DNA they carry that contain this RFLP (for clarity, we will only see one of the two stands of DNA). Since Jack and Jill are both diploid organisms, they have two copies of this RFLP. When we examine one copy from Jack and one copy from Jill, we see that they are identical: Jack 1: -GAATTC---(8.2 kb)--- GCATGCATGCATGCATGCAT ---(4.2 kb)---GAATTC- Jill 1: -GAATTC---(8.2 kb)--- GCATGCATGCATGCATGCAT ---(4.2 kb)---GAATTC- When we examine their second copies of this RFLP, we see that they are not identical. Jack 2 lacks an EcoR I restriction site that Jill has 1.2 kb upstream of the target sequence (difference in italics). Jack 2: -GAATTC--(1.8 kb)- CCCTTT --(1.2 kb)-- GCATGCATGCATGCATGCAT --(1.3 kb)- GAATTC- Jill 2: -GAATTC--(1.8 kb)- GAATTC --(1.2 kb)-- GCATGCATGCATGCATGCAT --(1.3 kb)- GAATTC- Therefore, when Jack and Jill have their DNA subject to RFLP analysis, they will have one band in common and one band that does not match the other's in molecular weight:
Image of page 2

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon