{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

In the segement of dna shown below you can see the

Info iconThis preview shows pages 2–4. Sign up to view the full content.

View Full Document Right Arrow Icon
In the segement of DNA shown below, you can see the elements of an RFLP; a target sequence flanked by a pair of restriction sites. When this segment of DNA is cut by EcoR I, three restriction fragments are produced, but only one contains the target sequence which can be bound by the complementary probe sequence ( purple ). Let's look at two people and the segments of DNA they carry that contain this RFLP (for clarity, we will only see one of the two stands of DNA). Since Jack and Jill are both diploid organisms, they have two copies of this RFLP. When we examine one copy from Jack and one copy from Jill, we see that they are identical: Jack 1: -GAATTC---(8.2 kb)--- GCATGCATGCATGCATGCAT ---(4.2 kb)---GAATTC- Jill 1: -GAATTC---(8.2 kb)--- GCATGCATGCATGCATGCAT ---(4.2 kb)---GAATTC- When we examine their second copies of this RFLP, we see that they are not identical. Jack 2 lacks an EcoR I restriction site that Jill has 1.2 kb upstream of the target sequence (difference in italics). Jack 2: -GAATTC--(1.8 kb)- CCCTTT --(1.2 kb)-- GCATGCATGCATGCATGCAT --(1.3 kb)- GAATTC- Jill 2: -GAATTC--(1.8 kb)- GAATTC --(1.2 kb)-- GCATGCATGCATGCATGCAT --(1.3 kb)- GAATTC- Therefore, when Jack and Jill have their DNA subject to RFLP analysis, they will have one band in common and one band that does not match the other's in molecular weight:
Background image of page 2

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
paternity Case Let's use RFLP technology to determine if Jack is the father of Jill's child named Payle. In this scenario, DNA was extracted from white blood cells from all three individuals and subjected to RFLP analysis. The results are shown below: In this case, it appears that Jack could be the father, since Payle inherited the 12.4 kb fragment from Jill and the 4.3 fragment from Jack. However, it is possible that another man with similar RFLP pattern could be as well.To be certain, several more RFLP loci would be tested. It would be highly unlikely that two men (other than identical twins) would share multiple RFLP patterns and so paternity could be
Background image of page 3
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page2 / 8

In the segement of DNA shown below you can see the elements...

This preview shows document pages 2 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online