Course Hero Logo

A mutation occurs when the base substitution results

Course Hero uses AI to attempt to automatically extract content from documents to surface to you and others so you can study better, e.g., in search results, to enrich docs, and more. This preview shows page 11 - 13 out of 50 pages.

A ___________mutation: occurs when the base substitution results in a different ______ acid being codedfor. Since there is a different amino acid in the polypeptide, it may not function correctly as theintermolecular bonds that give the unique shape of the ___________ structure may be changed and hencethe whole shape of the protein will be different.A _________ mutation: occurs when the substitution does not result in a different amino acid being codedfor. The polypeptide will therefore contain the same ___________ of amino acids and so will still functioncorrectly.A _____________ of a base occurs when a nucleotide is lost. The polypeptide chain is often completely different dueto the fact that there is a ________ shift. The reason for this is because the nucleotides are read in threes (the__________ _______) and so when a nucleotide is removed, the bases are read in different units of three. A deletionat the _________ of a polypeptide is more likely to have an effect than if it was at the ______. An addition mutationwould have a similar effect to a deletion mutation.Mutations can arise spontaneously but most commonly occur during DNA _____________. The _______ of genemutation can be influenced by mutagenic agents, such as high _________ radiation, ______________ and___________. Mutation can increase species ___________.Answer the questions1.Transcribe the DNA sequence into mRNA then use the table to translate the mRNA into an amino acidsequence. If you use the single amino acid letter code it will spell a message.TACGCATTACGATAATCACCAGCACTTCGATGAATTAA codeAA single letter codeRNA codonAlaAGCUCysCUGUAspDGAUGluEGAAPheFUUUGlyGGGUHisHCAUIleIAUULysKAAALeuLCUUMetMAUGAsnNAAUProPCCUGlnQCAA
ArgRCGUSerSAGUThrTACUValVGUUTrpWUGGTyrYUAU2. Below are sequences of the same piece of DNA that contain different mutations. For each, describe what hashappened to the DNA sequence and how this would this affect the protein.Silent Mutation:TACGCATTACGATAATCACCAGCACTCCGATGAATTDeletion:TACGATTACGATAATCACCAGCACTGCGATGAATTQ2.The figure below shows part of a pre-mRNA molecule. Geneticists identified two mutations that canaffect this pre-mRNA, as shown in the figure.Base sequence codingfor amino acidsBase sequence removedfrom pre-mRNABase sequence codingfor amino acidsMutation 1,single basedeletionMutation 2,single basesubstitution(a)Mutation 1leads to the production of a non-functional protein.Explain why.

Upload your study docs or become a

Course Hero member to access this document

Upload your study docs or become a

Course Hero member to access this document

End of preview. Want to read all 50 pages?

Upload your study docs or become a

Course Hero member to access this document

Term
Spring
Professor
N/A
Tags

Newly uploaded documents

Show More

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture