What website did you use to input your accession

  • No School
  • AA 1
  • 15

This preview shows page 11 - 14 out of 15 pages.

What website did you use to input your accession number? What database did you use to get the consensus pattern? What is the consensus pattern for the protein you were given? What BLAST algorithm will you use to find the sequences with a shared consensus pattern? 11 Dr. Balan PhD Tutorial 1
Image of page 11

Subscribe to view the full document.

UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 3. On your own, for practice, explore the workings of PSI-BLAST and DELTA-BLAST with the protein sequence given below from UniprotKB. This protein synthesizes THC, a psychoactive constituent of cannabis. Protein: THCAS_CANSA What does a PSI-BLAST construct? Why do we have iteration in PSI-BLAST? What does DELTA-BLAST look up as its foundational criteria? 12 Dr. Balan PhD Tutorial 1
Image of page 12
UNIVERSITY of HOUSTON Department of Biotechnology BTEC 4300/6304* Principles of Bioinformatics/Computational Methods in Biotechnology 4. Find the FASTA format nucleotide sequence for Cherax sp. B27 Black Scorpion 16S ribosomal RNA gene, partial sequence; mitochondrial (Accession Number: KU821428.1) and paste an image of your result. What website database did you use to look up the FASTA? How did you filter your search criteria on the data base? Fasta: 5. Run the following sequence through blastn with default parameters; CTACCCAGACGCTAGAAGTGGTATTGTCCGACAATCAGAGGCAGTCAGTCGACTCCATGCACGCGCTGGTGTAGCGGTGCCGCTACTCCATCCTGTGACGTTGAAAACTTCGATAGTGTCACCTTAACTCGACTTCGCT TCCGGCCCGCTCGACACTGTGGTGTGATAACTTTTAACACTAGCTCTAATCGTCTTTCGTTCGTAATCAGTTTGCCATCGACTGATAGAATCGGGGGTGTAGTACTTTAGATGTTTCGGGCCGGCCTAGCCGGTGGACGTC GTGCCTAGAGCTTGGCCTAACAACCCGATGGCACAGAGGTACGAAGATACGATGTCCCACTATGGGGCTATGGATGGCCCGGCTTCGATCTACGATCCACACGCCCACAGGTCCATGCAGACCTTGTCTCATGCGCCTC ACATGAATCACACGCCTGCCATGCACCAGTATCATGGAAATCACGTTTCTTCGGTCATGTCCAATCACGTTATGGGCTCCGTGCCCGATGTTCATAAGAGAGACAAAGATGCCATTTACGGCCACCCACTCTTTCCCCTC CTGGCACTGATATTCGAGAAGTGCGAACTTGCAACTTGTACACCTCGAGAACCGGGAATTGCAGGTGGGGACGTGTGTTCATCAGAATCTTTTAACGAGGACATCGCTGTATTTGCTAAACAGATGGTCCAAGCCATTC AAGTGTTGAGGTTTCATCTACTAGAATTAGAAAAGGTGCACGAGTTGTGTGATAACTTCTGCCAGAGATATATAAGCTGTCTGAAGGGAAAGATGCCAATAGACTTGGTTATAGATGAAAGAGACGGAAAACCCGGAGA TTTGGGGGATAACAACAACAACAGCAACTGTAGCAGCAACTGCGGAGGAGGGAACCATACAGGAACCGGAGGTGGAGGACACAGGGGCCTCCTCGACACATCGGGTCATAACAGTAGCGACAGTGCCTCTACTCCC GACCAGGCCTATTGTTTCTCCCCACAGAGACCGCCCTCCCAGTCCCTGAATTCCTATAGCACCGGTCCCGACGATGTAAGGTCTCCAGCAGGGTCGACAGGGACACCGGGCCCCCTCTCCCAACAACCCAGCTCCCAG CAGAGCACCGACAATAACAGCGAAGCTGGTGATGCCAGTGTAGGCTCGGGAGACGGAACAGGCGAAGATGATGACGACGACAGAGGGAAGAAGAGACAAAAGAAAAGAGGAATCTTCCCGAAAGTCGCCACAAA CATCATGAGAGCCTGGTTGTTCCAACATCTCACTCATCCATATCCATCTGAAGATCAGAAGAAGCAATTAGCGCAAGACACTGGGCTTACTATTCTTCAAGTTAATAATTGGTTCATCAATGCAAGGAGAAGAATAGTGC AGCCGATGATTGATCAGTCTAATCGTGCGGGTGGATCTATTGGCGGAGCGAGTACCGCCTACAGCCCGGAAGGTGCGGGGATGGGTTACATGATGGACGGTGGTCAACAGATGCACATTAGACCTCCAGGTATGCAAA ACCTTCCTTGCACCGACGGTTCCATAGGCATGGGTCACATGGGCAGCATGGGCGGATATTCCCAGATGTCGCAACTCAGATCGCCCGTTCACTCGCAGGCCATGCTACTACCCGGGCATCCTCACGCAGCCATGATGATG ACGCACGGACCTATGGGCCATCCGGGCATTCCACCTCAGGGTTCGCCGTACGACGGATCGGGACAACACATCATGGATATTCACGCCAGTTAATGTATTTCTGTACGAATGGAGAACACAGCTCTTTCCCCTTCCCGGTT
Image of page 13

Subscribe to view the full document.

Image of page 14

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern

Ask Expert Tutors You can ask 0 bonus questions You can ask 0 questions (0 expire soon) You can ask 0 questions (will expire )
Answers in as fast as 15 minutes