BIO 313 Zebra Fish Embryo.docx

In the developing eye pax2 is expressed exclusively

Info icon This preview shows pages 3–5. Sign up to view the full content.

In the developing eye, Pax2 is expressed exclusively in the optic stalk (Macdonald 1996). In our experiment we will be isolating RNA from the zebrafish embryos at two different times post fertilization. We will be using the technique of reverse transcriptase polymerase chain reaction (RT-PCR). This process will be used to create cDNA from the mRNA through reverse transcription and will be amplified to show expression. The final separating technique that we used was gel electrophoresis. This rapid and simple technique involves separation of free DNA from DNA-protein complexes based on differences in their electrophoretic motilities in polyacrylamide gels. Under favorable conditions both unbound DNA and DNA associated with protein can be quantified (Garner & Revzin1981). Our goal was to determine whether expression has changed in different versions of the pax2 and pax1 genes over the past several hundred million years. Material and Methods The first step in testing the hypothesis concerning embryonic development was to design primer pairs for PCR. This was done by using several software programs and genome sequencing databases. Zebrafish pax2a/2b and pax1a/1b genes were identified via a homology search on the Ensembl database ( ). After downloading the 3
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

sequence that includes introns and exons the next step was to locate the primers. Here it is important that we chose a gene with multiple exons in order to differentiate the cDNA from the gDNA after RT-PCR is ran. After obtaining the sequence for the pax2 and pax1 genes we used the primer tool ( ). To amplify the coding sequence from the cDNA, the following primers were used. Pax2a: sense, CCAAAGTTCAGCAGCCTTTC; antisense, GTTTTCTCTTTTCGCCGTTG. Pax2b: sense, GTCAACGGGAGGCCTTTAC; antisense, CCACTTTAGGCTTGGATCCTC. Pax1a: sense, CAGCACAGTTAAAGGTTACG; antisense, GGAGGTTTTGCTGTCATACT. Pax1b: sense, GGCTTAGTCCTAAACTCAGACACAT; antisense, ATTTTGGGCTGATAACTCTCTGAT. We chose this single pair of primers for each and verified that the primers were in different exons by searching for them in the sequence. We did this by pasting the sequence into a word document and searching the document for the forward primer. In order to locate the reverse primer, we converted it to its reverse complement (lab 9 pg. 8-12). Total RNA was prepared from tissue at two different time points; 27 hpf and 75 hpf. An RNeasy kit was used for the purification process. We used it to purify RNA from the small amount of starting material. We added 600 l of Buffer RLT containing -mercaptoethanol and homogenized the tissue with a sterile micropestle to prevent contamination. In order to separate the supernatant, we centrifuged for three minutes. Next 600 l of 70% ethanol was added to ensure appropriate binding conditions. We added 700 l of the sample into the RNeasy spin column to separate the mixture. After centrifuging for 15 seconds at 8000g we added 700 l of Buffer RW1 and repeated centrifuging. This was repeated again after adding 500 l Buffer RPE.
Image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern