life on planet earth exam 3 Flashcards

Terms Definitions
eats plants
herbivore
doesnt require data
deductive
the figure illustrates
c.
formed by food webs
ecosytem
the above figure illustrates
a.
given this mRNA sequence, GCUAUCUGUCAUAAAAGAGGA, witch of the following represents the complementary DNA coding sequence
c.
the fundimental unit of life
d.
natural selection can cause populations of a species to
a.
priotity of senses, explanations are from empircal evidence
induction
observation, question, explanation, hypothesis, theory
progessions of confidence
decent with modification is the definition
c.
one function of meiosis is to
d.
species a currently given names using
B.
after a gel electrophoresis procedure is run, the patern of bars in the gel shows
c.
reptiles are much more extensively adapted to life on land than amphibians because reptiles
c.
light
green plants take in utilizable energy in the form of
predators that feed on other predators
secondary carnivore
the central dogma of molecular biology is
d.
in order for biological evolution to proceed, which of the following process types are necessary
c.
as a mechanism of evolution, natural selection can be most closely equated with
b.
genatic drift results in a -----effect within species
a.
is the idea that earth has been affected in the past by sudden, short loved, voilant events
catastrophism
primary carnivore
in which trophic level would you expect to find the greatest concentration of DDT
witch of the fo;;owing is NOT involved in translation
b.
which of the following ideas was not given to us by Linneaus
d.
the graph (a) indicates which f the following processes
d.
cells are the basic unit of structure in every living thing
cell theory
Factors the determine the distribution of Biomes among the Earth:
1. Temperature
2. Soil
3. Precipitation
4. Latitude
5. Altitude
6. Light
an overarching well-substantiated explanation
in the scientific community a theory means
no big bang, biological species were created at one time and still exist
age of the world
raising the atmospheric CO2 concentrations
combustion of fossil fuels may be contributing to global warming mainly by
reproduce, respond to stimuli, they are complex and organized, and they acquire energy
what are the characteristics of living things
What affects does Climate Change have on the distribution of Life on Planet Earth?
Rising temperatures could cause some species to shift to cooler areas (or at least try too).
This in turn can cause species interactions related to invasive, competition, prey/predator balance.
Species that are unable to move due to physical barriers the danger of becoming extinct.
Climate change can also affect the availability of food, shelter and water.
An increase in pests and diseases
Frequency of natural hazards
evolution of the moth was pushed by pressues of the environment
the peppered moth in pre-industrial and industrial Britain demonstrated
How can changes in Temperature affect Biodiversity in Tropical Areas?
Loss of poorly adaptable species that are not used to change.
Spread of pests and diseases
Storms, Forest Fires, Droughts, Floods, Heat Waves etc
the arctic icecap is floating and takes up more space than water
the thaw of the icerap floating on the arctic ocrean does not affect sea levels as much as the melting of the greenland icecap because
/ 36
Term:
Definition:
Definition:

Leave a Comment ({[ getComments().length ]})

Comments ({[ getComments().length ]})

{[comment.username]}

{[ comment.comment ]}

View All {[ getComments().length ]} Comments
Ask a homework question - tutors are online