Biology questions and answers in June 2019

Which of the following scientists is incorrectly paired with their contribution to the discovery of the structure of DNA? Chargaff; %A=%T and %G=%CFranklin; x-ray diffraction images of DNA heli...

Mount Everest is about 8,000 meters above sea level. If the air at the top in winter is -45ºF, then how warm would it be if it descended adiabatically to sea level?

I have shortened the questions. I am unsure what the answers are to the following Biology practice questions. Could you please provide an explanation as to how you got the answers if possible??? Thank...

1. The food center in the brain is located in the ______________________. 5. ______________ is the removal of an electron, while _____________ is the addition of an electron. While reactions that...

4. Dizygotic twins are formed from the combination of _________ ova and __________ sperm, while monozygotic twins are formed from the combination of _________ ovum and _______ sperm. Conjoined twi...

I am unsure of the answers to the following practice questions, could you please help and provide an explanation as to how you got the answer? Thank you! These are all biology questions #21Which of th...

9. What is the muscle that helps to prevent the sperm from dying due to temperature? 10. The ovaries are to the female gonads as _____________________ are to the male gonads. 11. Follow the p...

#1 Select all the results of the short-term stress response. Blood pressure increases. Blood flow to the heart and muscles increases. Glucose is released into the blood. Breathing rate slows. Digestio...

Saved Which characteristic is common to all chordates? Question 14 options: A) They all have vertebral columns. C B) They all exhibit radial symmetry. C) They all have a notochord sometime during the...

Truffle mushrooms are an example of Question 1 options: A) a parasitic fungi C B) a commercially important fungus C C) a photosynthetic autotroph C D) seed producing organisms

You have a segment of DNA with the sequence AATAGCGA. If this segment underwent replication, what is the nucleotide sequence you would see?

Identify a synovial joint in the body. Can you identify all the parts of that joint? How many ligaments are reinforcing the joint? Are their named meniscus, labrums, or bursae? How strong is it, wh...

3. INPATIENT HOSPITAL Gender: M Age: 25 Reason for admission: assault by handgun to leg 6 weeks ago. Patient was treated for fracture to femur caused by a bullet. Bullet was removed but f...

Describe the environmental conditions that favored the evolution of gymnosperms as well as three adaptations to life on land that first appeared in gymnosperms.

Describe the relative abundance of prokaryotes on Earth and how they can affect humans and ecosystems.

Identify the sequence and timing of the major events in the evolution of early life, ending with the evolution of humans.

Compare the body structure, lifestyles, and feeding strategies of the nine major animal phyla, distinguishing between distinct sub-groups of these phyla.

Distinguish between the four stages of the hypothesis for the origin of life on Earth, and explain how natural selection would have affected the first pre-cells.

Compare aquatic and terrestrial adaptations of amphibians, adaptations of reptiles to life on land, and adaptations for flight found in birds.

Describe the characteristics common to all mammals, distinguishing between monotremes, marsupials, and eutherian mammals.

1. If an individual weighs 100 lbs. How much of that weight would be water? ____________ 5. If you were working in the ER and a car wreck patient came in and you were told to start an IV with...

1. Put the following in order: 1. Movement 2. Digestion 3. Absorption 4. Ingestion 5. Defecation 6. Secretion Order: _________________________ 8. Where the esophagus passe...

How is blood different from other connective tissues in the body? Which organelle is the site of protein synthesis? What is it made of and where is it located? What organelle would be of most importa...

Can I please get some help with the following question... Quiz Instructions Learning o_bjective: . You will be able to illustrate the difference between Mendelian, X-Iinked, incomplete dominance, co- ...

can lung cancer ever be cured? why or why not? explain on a cellular level and your perspective as well

Describe what occurs during the light reactions.

1. How many bones are in the average adult? _____ 2. Match these: Transverse ___ A. Cuts the body into anterior & posterior ...

A man and his wife both have normal color vision, but they have a daughter who has red-green color blindness, a sex-linked recessive trait. The man sues his wife for divorce on grounds of infidelity....

Can someone review my answer to the question? What functions do the vascular tissue and stomata carry out for the plant? Vascular tissue runs through the ground tissue inside a plant. The ground ti...

Can some review answer to the question. What functions do the vascular tissue and stomata carry out for the plant? Vascular tissue runs through the ground tissue inside a plant. The ground tissue t...

Would this be something like adaptation? In early spring} Dr. Tom Wilson notices that there is an equal distribution of long and short stemmed buttercups in the vacant lot across the street from his h...

I am having a hard time finding information that I feel is specific enough to answer the question of "briefly contrast the traditional methods used to create vaccines with more recently used biotechno...

A subject has the following results after 4.0 minutes of a CO 2 rebreathing test: Time-------------0--------------4 minutes Pet CO 2 --------37--------------57 V E (L/min)-----5.0-------------12.5...

list three reasons why people suggest that biodiversity conservation is important.

Where are the photoreceptor cells of the eye located? Cones vs. Rods; functions?

Some neural tissues retain stem cells and thus the capacity to divide and replace lost neurons. Which of the special senses can replace its damaged neural receptors? What are the six primary taste sen...

Why is it necessary for the daughter cells of meiosis to result in 23 chromosomes, rather than 46? Also a friend asks you the question, "Why is sexual reproduction (meiosis) evolutionarily significant...

in a human population, the I A , I B , and I O alleles are present in a ratio of 5:4:1, respectively. What are the frequencies of the ABO blood types in this population assuming random mating?

Define and describe the six steps of the scientific method. Give an example of each step.

aved Where is this molecule normally found in a eukaryotic cell? Question 1 options: A) cytosol B) Golgi apparatus C) nucleus D) rough endoplasmic reticulum

Saved Cells in the thyroid gland produce and secrete thyroid hormone (a polymer of amino acids) that helps to regulate metabolism. What organelle is most likely abundant in cells of the thyroid gland...

( Lung Cancer) Examine what went wrong with the normal cellular function to cause that neoplasm. Explain how the cell reproduction rate and differentiation are kept within the normal range to avoid th...

For my lab, I did an agar deep of a sample that was reported to have the ability to undergo both aerobic respiration, anaerobic respiration and fermentation. But, when I looked at my results, growth w...

How did this person solve this question? or How to this question?

List 5 characteristics of gymnosperms. What features not present in seedless plants have contributed to the success of seed plants on land? Validate your answer with specific examples and details. Ide...

31. A multicellular organism that carries a specific genetic change in each cell because of an intervention at the fertilized egg stage is: Select one: a. transverted. b. translocated. c. transgenic. ...

26. The part of the genome that encodes protein is called the: Select one: a. encode. b. intron. c. primer. d. exome. 27. The protection against a specific infectious disease that arises when all or n...

18. Response to Gram stain depends on the structure of a bacteria's a. ribosomal RNA b. G+C ratio c. cell wall d. none of these 19. There are about species of bacteria that have been identiﬁed, w...

11. After 5 hours under good conditions, a single bacterium could grow into a colony containing _ bacteria. a. 20 b. 8,000 c. 33,000 (1. 250,000 e. 8 million 12. Which is NOT an antibiotic? a. penici...

Go to http://www.mhhe.com/biosci/genbio/virtual_labs_2K8/labs/BL_09/index.html and read the material in the left hand column entitled "How Can Bacteria be Identified?" Follow the directions...

21. Which of the following techniques is most likely to lead to heteroplasmy (hint: remember this term from module 3!)? Select one: a. cytoplasmic (ooplasmic) donation b. embryo adoption c. in vitro f...

16. A(n) _______ is a type of cancer-causing gene that promotes cancer by activating cell division at an inappropriate time or place. Select one: a. DNA repair gene b. tumor suppressor gene c. oncogen...

The tiniest, most miniscule bit of a pure elemental substance is

11. Infertility and spontaneous abortion increase with age primarily due to: Select one: a. uterine fibroids. b. endometriosis. c. highly acidic or basic vaginal secretions. d. higher production of oo...

Biology Lab 100 1. Construct a line graph based on the data from Table 1 in the space below. Place the day on the x-axis, and the number of seeds germinated on the y-axis. Be sure to include a ti...

1. Germline gene therapy would correct a genetic defect in: Select one: a. an unaffected individual only. b. an unaffected individual and his or her offspring. c. an affected individual and all of his...

4. Describe the appearance of a pedigree and discuss its importance in tracing inheritance patterns. Explain how a pedigree can illustrate the following types of inheritance: Autosomal recessive Autos...

3. Explain how each of the following rules applies to monohybrid crosses and give a specific example of each rule: Multiplication rule Addition rule

2. Give an example of an organism that has a sexual life cycle and briefly describe this cycle. Explain how and why fertilization alternates with meiosis through successive generations. Also, discuss ...

1. Compare meiosis to mitosis. In your detailed explanations of the differences between these two processes make sure you point out the specific stages that result in "reduction division," the change ...

Can you explain the difference between a co-enzyme and a co-factor?

1. Describe a standard cultivation method for the enumeration of viable bacteria. Using a named example explain how some bacteria are viable but unable to be cultured. 2. Describe the lifecycle of the...

1. Describe how actin and myosin work in conjunction with each other to power movement in skeletal muscle. 2. During exercise the concentration of adrenalin in blood plasma reaches 100ng/L. Explain ho...

1. Which of the following sequences cannot exist for a mRNA. Explain your answer. a. ATTGCC b. UTTCTTT c. AAAAAA d. CCCCC 2.Some antibiotics are used to kill bacteria by stopping t...

You have been designated to choose a place for wildlife and ecosystem preserve. You want to choose a biodiversity hot spot. Which location would you choose? Indo-burma rainforest Scandinavian taiga ca...

In BIO 101, Explain why life cannot be defined. It cannot be simply defined because living things exhibit way too much ____ and ____. I've read the text a few times but still at a dead end.

The step in DNA analysis that permits comparison of DNA from different samples is DNA sequencing Gel Electrophoresis restriction enzyme digestion PCR VNTR

I need to answer these questions Explain two ways in which a stationary specimen can be "lost" when examining it under a microscope. For each, explain how to solve the problem.

the width of one of the crossed threads (Show your calculations for this one)

In spiders, a particular gene locus exists in five alleles ( A , B , C , D , and E ). A population of 30 individuals was sampled and the genotypes were represented as follows: a. ?...

compare and contrast the following mechanisms. Be sure to include how each deviates from simple Mendelian inheritance. - Maternal inheritance - Genomic imprinting -...

In a harsh climate, what decides who will live and who will die?

1. The humoral immune response is mediated by: Select one: a. B cells b. NK cells c. cancer cells d. none of the above 2. The alteration of cells outside of the body constitutes what type of therapy? ...

How can one distinguish between an X-linked trait and a cytoplasmically-inherited trait?

Consider two mice that are heterozygous for insulin-like growth factor 2. From the cross: Igf2 Igf2m X Igf2 Igf2m .... what genotypic ratio would be expected? b. what phenotypic ratio would be...

Coat color in rabbits is under the control of a single gene with four alleles: C (full gray color); c ch (chinchilla, light gray); c h (Himalayan, white with black extremities); and c (albin...

The sex determination mechanism of mice is similar to that of humans, with one notable exception: mice that are XO aneuploids are functional females. 1. In a mating of an XO female with a normal male...

Dba replication occur with or without the aid of enzymes. True or fslse

Transcription of dna and translation of mrna both occur in the cytoplasm in prokaryotic and eukaryotic cells. True or false

Hello, I would like to know how to do the graph for. Exploring Photosynthesis and Plant Pigment. How did the baking soda solution affect photosynthetic rate? Graph the result.

omo sapiens (modem human) _-lI--- (extinct hominid) ' usn'alopithecus : farensis (extinct hominid) _-lI--- Skull Conclusion: Be sure to answer the following reflection questions in the conclusion o...

Can someone look over my work to see if it's correct and free of grammatical errors?

10. Describe how the layers of the skin change as you move from the surface to the deepest part of the skin.

8. How thick is the epidermis, in number of cells? Give a range from minimum to maximum cell thickness.

6. Which blood cell type was most common in the image you observed? Why?

12. How does the arrangement of tissues differ between arteries and veins?

In humans, the ability to taste the bitter chemical PTC is inherited according Mendel's pattern of inheritance. The taster allele 'T' is dominant to the non-taster allele 't'. What are the possible ...

Give an exampe of an experiment using mice that would allow you to examine whether T FH or T H 2 cells were important in mounting an allergic response to cashews.

Give an example of three common allergens and for each allergen, list and describe the function of three allergenic components found within the allergen.

Explain OIT, SLIT, EPIT, and subcutaneous immunotherapy.

I got these wrong on my final and have no way of finding the right answer now that i'm no longer in school out of curiosity can someone give me the correct responses? 1.Accommodation for focusing up c...

Transcription builds ____, whereas translation builds _____. DNA; RNA RNA; proteins RNA; DNA proteins; DNA

How to self-measured different bone sizes of my own accurately as requested in an assignment using a soft measuring tape? Is there a better tool other than the soft measuring tape that I can use for t...

Design an experiment using mice that would allow you to examine whether T FH or T H 2 cells were important in mounting an allergic response to cashews.

Describe the immunological mechanism behind each of the immunotherapies : OIT, SLIT, EPIT, and subcutaneous immunotherapy

Explain the immunological mechanism of sensitization to food allergens.

Why is sugar phosphate backbone important in DNA? Can you please explain?

1, the organelles of Amoeba responsible for locomotion are? a. contractile vacuoles b. pseudopodia c. food vacuoles d. mitochodria 2. Pheretima and Lumbricus both belong to which phylum? 3,The gastrov...

Questions: 1. What percentage of the cells in a strawberry contains DNA? Explain your answer. 2. How many DNA molecules are extracted from each cell of the strawberry? 3. Assuming the strawberry you u...

Use a DNA-RNA-protein synthesis kit to synthesize starting with the DNA template, an amino acid sequence for the polypeptide shown below. Using Table 1 and what you observe with the DNA-RNA-protein sy...

Also Determine the Amino Acid Sequence. g. For the following mutations, show the effect by indicating the mRNA codons and the amino acid sequence in the polypeptide. Show synthesis of the amino acid s...

g. For the following mutations, show the effect by indicating the mRNA codons and the amino acid sequence in the polypeptide. Show synthesis of the amino acid sequences with a DNA-RNA-protein synthesi...

f. Consider the following hypothetical gene. Indicate the mRNA codons that it forms and the sequence of amino acids produced in the polypeptide chain. Show synthesis of the amino acid sequence with a...

e. Molecular biologists use probes of mRNA to locate specific gene loci on DNA segments. Use the codon sequences determined in 3d as probes to locate the gene (complementary base sequence) in the seg...

b. Complete the figure below by adding the bases in the anticodons of tRNA and the base triplets of DNA. DNA template MANA codons UGG GUU AUG AAA Anticodons of IRNA Tryptophan Valine Methionine Figur...

3. PROTEIN SYNTHESIS a. Write the term that matches each description. 1. Carries the genetic code to ribosomes 2. Formed by an mRNA base triplet 3. Specifies a particular amino acid 4. Sites of prote...

The following figure shows a portion of a DNA molecule whose strands have separated to synthesize mRNA. The bases are shown for the strand that is not serving as the template. Add the bases of the DNA...

2. RNA SYNTHESIS a. Write the term that matches each meaning. 1. Sugar in an RNA nucleotide 2. Number of nucleotide strands in RNA 3. RNA base that pairs with adenine 4. Template for RNA synthesis

for a. 1-8 write the term that matches each phrase 1. Molecule containing genetic information 2. Sugar in DNA nucleotides 3. Pyrimidine that pairs with adenine 4. Purine that pairs with cytosine 5. Ch...

Can I please get help with this problem. Instructions Continued from Part 1: Dogonia and spermatogia are the diploid egg and sperm cells that undergo a specialized type of cell division (meiosis) to m...

Cystic fibrosis is a genetic disorder in homozygous recessives that causes death during the teenage years. If 9 in 10,000 newborn babies have the disease, what are the expected frequencies of the domi...

All creatures living today can be connected back in time by: a meteorite strike the moving continents common ancestor all of the above

A sixty-year-old baker presents to your clinic, complaining of increasing shortness of breath and nonproductive cough over the last month. She even has to sleep upright in her recliner at night to be ...

5. Esﬁmate the half—life of element X whese rate of decay is shown in figure 3. E. If 315% of the original amount of element X remained in a sample, what would you estimate its age to be? T. How ...

The secondary structure of a protein consists of a single long beta sheet. The outer edges of the beta sheet are composed of serine and proline amino acids. Describe the effect changing all the serine...

How does chlorpyrifos work? How do enzymes work, both structurally and energetically. Also, how do enzyme inhibitors work, including different types of inhibitors such as competitive, allosteric, a...

1.What disease do you think Evan most likely suffers from? What evidence supports your choice? 2. Evan complains that the air in his lungs "doesn't want to go out." Which muscles in his body are li...

1) Formulate a diet to meet the Lys requirement (total basis) of a 60 1b pig. The diet should include: Corn SBM (with hulls; 43.8% CP) 2% choice white grease 0.5% TM premix 0.30% Vit premix 2% dicalc...

Whats the best way to study for a Chemistry II test?

What would fruit represent in a forensic scenario ?

I'm in Biology 103 for UMUC is there a good example of Lab 2 to answer these questions? Procedure I - Group 1: Known Sample Solutions Complete the table below using your data from Procedure I. For...

Describe an experiment that you could use to determine if a bacterial sample taken from a person was resistant to aminoglycosides. Be sure to describe all steps of the experiment including your indep...

Starting with blood in the superior and inferior vena cava, it first enters the right atrium. From this point, indicate the path of the blood as it circulates through all four chambers of the heart, t...

Case 2 Number F alleles/ Frequency Number F alleles/ Frequency Generation of F Total of of f Total of alleles alleles P alleles alleles q O START 75 75/100 .75 25 25/100 .25 2 3 4 5

Case 1 Number F alleles/ Frequency Number F alleles/ Frequency Generation of F Total of of f Total of alleles alleles P alleles alleles q O START 75 75/100 .75 25 25/100 .25 1 2 3 4 5

number of offspring with genotype ff x 2 = f alleles + number of offspring with genotype Ff Total f alleles = (add this to chart below)

Question 1? {5 points] Question 1? Saved Which of the following statements about this food web are TRUE? Select all that apply. Question 1? options: This food web include examples of bird species tha...

#1. What does Inhalation toxicity of solvents: Depends on....? #2. Which of the statements regading the distribution of Xenobiotics to tissues is FALSE?

How can bacteria become resistant to aminoglycosides? And what would the mutation and natural selection be?

1. The food center in the brain is located in the ______________________. 5. ______________ is the removal of an electron, while _____________ is the addition of an electron. While reactio...

What is most likely to be true if you digested the mutant pGLO DNA with NdeI only rather than inserting the DNA with both the NdeI and Psil restriction enzymes ? a) No DNA fragments will be produced...

You will compare the banding patterns between your digested mutant pGLO DNA and the digested control pGLO DNA. There will be four DNA fragments produced by digesting your mutant plasmid with the enzym...

What is the role of dna profiling criminal forensics

How does tetracyline kill bacteria? Is tetracyline antibiotic selectively toxic? Please explain your answer, including the definition of selective toxicity. How could a bacteria become resistant ...

Which of the following statements is true of nerve conduction, membrane transport, protein synthesis, and muscle contraction?

Describe the fluid mosaic model. What mechanisms drove molecules across membranes? In the supermarket, lettuce and other produce are often sprayed with water. Explain why this makes vegetables crisp...

In a rural city country "A", the incidence rate of a disease is seven times greater in women than in men, but the prevalence rates show no sex differences. Why?

Choose one of the four forms of cell signaling and describe it in detail using examples. Relate the development of such systems with the evolution of multicellularity and apply this to an explanati...

When pyruvate is allowed to move into the mitochondrion, the pyruvate is converted into

Please help with a hardy Weinberg equation. my project is genetics. I counted a total of 55 earlobes I have 10 attached earlobes and 45 detached earlobes what is the Hardy Weinberg equation

Cystic fibrosis is an autosomal recessive disease characterized by two copies of a mutated CFTR gene. If one in 100 people in the United States have cystic fibrosis and one in 5.0505050505 people are ...

Use this to move a sample to view a different part of it mounted on a slide. Use this to move a sample to View a different part of it mounted on a slide.

Why is it important to maintain biodiversity in every ecosystem?

Should humans be concerned with the extinction of "pests" like mosquitoes? Why or why not?

Your friend says that humans have evolved from apes. How would you respond to that statement using the information provided in this chapter?

Upon inspiration, what is the name of the air in the conduction zone that is not available for gas exchange?

Please Solve this Problem: Adult male: EER = 1241 − [9.53 x age (y)] + PA X [15.91 x wt (kg) + 5.39.6 x ht (m)] Age = 34 years Height = 1.7 meters Weight = 95.25 kg Please show process to get to...

Experiment 1 Results Tables Table 1: Experiment 1 Growth Results Condition Day of First Visible Extent of Growth on Extent of Growth on Growth Bread (Mean) Apple (Mean) Bright, Control Bright, Water ...

1. Describe the key events in meiosis that lead to genetic diversity among gametes. Click here to enter text.

Please solve this problem: Adult male: EER = 662 − [9.53 x age (y)] + PA X [15.91 x wt (kg) + 5.39.6 x ht (m)] Data needed to solve problem: Age- 34 Weight- 95.25 KG Height- 1.778 meter

What is the function of cellular respiration? How does cellular respiration functions equip cells for the work they must do?

First. What results ensue when both bacillary infection and unhygienic surroundings are made to coexist in tuberculosis? Second. Are unhygienic surroundings when every known precaution has been taken ...

What are the answers to the questions attached to the picture.

3. Describe the key events in meiosis that lead to genetic diversity among gametes Fill in the table below for Mitosis and meiosis Chacteristic Mitosis Meiosis Function Type of reproduction Types of c...

View Full Description Hide Full Description Week 4 Antibiotic Resistance Initial post due on or before Wednesday Two Reply posts to peers due by Sunday Antibiotics are commonly used to treat infection...

Part I - Introduction Victoria adored her older brother Travis. She had good reason: their father had died when they were kids, leaving them and their younger twin sisters to be raised by their mother...

2. Credibility is an important concept both in science and in courts-of-law. Which of the two publications is more credible, and why?

Pick two different organisms (any kind you want) and describe how each one answers the question of "Why (or Why Not) Sex?". Be sure to describe how the organisms reproduce and how (or if) this affects...

Which event may lead to cancer? Select all that apply. A. gene mutation B. functioning p53 protein C. Rb protein phosphorylating D. Improper replication of DNA during synthesis E. faulty DNA repair

What association is correct? Select all that apply A. phosphodiesterase- removal of phosphate B. kinase-addition of phosphate C. phosphorylase-breakdown of glucose D. adenylyl cyclase-ATP to cAMP ...

A sticky substance that oozed out of conifer trees 30 million years ago can now be purchased in fine jewelry. What is this substance? What was its original function for the tree? How else is it use...

30. Introns are known to contain stop codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? a. UAA, UGA, and UAG are initiator codons, not termination ...

20. As a student of tropical biology, you are surprised by your studie. . new species of colorful frog, which occurs in two strains, one of which has blue spots ( strain 1) and the second which has p...

26. The given mRNA sequence is transcribed from the gene below it. 5' AGCUUCGAACUCAUGCAGGGCCACCCGAUVACCAUGUAAGUUACGCA 3' 3'TGAAGCATATTAGTACCGATGTCGAAGCTIGAGTACGTOCGGGTGGGCTAATGGTACATICAATGCGTS' 5&quo...

12. Initiator proteins does which of the following? a. seal nicks between DNA fragments b. bind to the origin of replication C. create RNA primers d. synthesize new DNA

11. A diagram of a linear chromosome is shown here. The end of each strand is labeled with an A, B, C or D. Which ends (A-D) could not be fully replicated by DNA polymerase? Why not? 2 pts 5'-A B-3' ...

9. If the activity of DNA ligase was removed from replication, more effect would be seen on a. synthesis on the lagging strand versus the leading strand. b. synthesis on the leading strand versus the...

I need help with this question part with part b not a. I need help with how it would be cis or trans. 3. In Drosophila, vestigial (short) wings (vg) are caused by a recessive allele of a gene that ind...

2. In corn, the gene for colored (C) seeds is completely dominant to the gene for colorless (c) seeds. A single gene pair controls whether the endosperm (the part of the seed that contains the food s...

1.Recombination between linked genes comes about for what reason?I a. Mutation on one homolo g is different from that on the other homolog. b. Independent assortment sometimes fails because Mendel ha...

The cancer I went with is breast cancer ( invasive ductal carcinoma) Examine what went wrong with the normal cellular function to cause that neoplasm. Explain how the cell reproduction rate and dif...

What is the fundamental difference between mitosis and meiosis? (What types of cells are produced by each? Where do these processes take place? How many stage are involved? How many divisions are ...

Discuss what Darwin observed during his voyage on the Beagle . How did those observations lead to his theory about common descent with modification? Use the scientific method in your discussion. Ste...

Table 2: Volume and Concentration Totals Table 1: Volume and Concentration Totals Trophic Level Cylinder Volume of H20 Volume of Oil Total Volume % Oil

1. Discuss what Darwin observed during his voyage on the Beagle. How did those observations lead to his theory about common descent with modification? Use the scientific method in your discussion. St...

what cross will result in all recessive phenotype offspring?

what is the principal diagnosis from this chart? what is the additional diagnosis? What do I code as services provided?

Check all that are guiding principles for the ethics of emerging technologies

Question 7 2 out of 2 points While the authors of A prudent path froward for genomic engineering and germline gene modification argue that while some precautions are appropriate, the ban on using CRI...

Question 3 2 out of 2 points biology. the futurist and billionaire Craig Venter has been outspoken in his opposition to synthetic

Dual use research is research that, while beneficial for its intended purpose, can also be used for damaging purposes. Question 5

Q4: Infer Currently, Loxodonta africana is protected from being hunted. How might reclassification affect the conservation of forest elephants? Answer:

Cyanide inhibits cytochrome c oxidase, a component of the electron transport chain. If cyanide poisoning occurs, would you expect the pH of the intermembrane space to increase or decrease? What affect...

DNA replication uses each strand of the DNA molecule as a template for the creation of a new strand copies DNA into RNA results in the formation of 4 new DNA strands begins when two DNA molecules exch...

The envelope of a virus accounts for resistance to antibiotics is coded by host genes helps the virus insert its DNA helps the virus enter the cell

In the genetic code: some codons consist of two nucleotides many amino acids are specified by more than one codon some amino acids are not specify by any codon some codons specify more than one amino ...

Genes located on the same chromosome are referred to as __________ genes and generally _________________. codependent; do not sort independently during meiosis linked; do not sort independently during...

The offspring of a blue-flowered plant and a white-flowered plant is all light blue. This means that the blue allele is co-dominant dominant incompletely dominant recessive

From an evolutionary standpoint, why does the inner ear of mammals use fluid pressure waves?

Energy cycles through our biosphere, it cannot be created nor destroyed and yet, is constantly lost according to the Laws of Thermodynamics. Discuss this as it relates to cellular metabolism. How much...

What effects might a steady increase of carbon dioxide have on the organisms living in the area?

are absorbed from the gastrointestinal tract. is formed as a byproduct of the breakdown o is conserved by the kidneys. n beverages that contain electrolytes.

Q. Action potentials can code for stimulus intensity by 1) altering frequency 2) altering magnitude 3) altering duration 4) altering both duration and magnitude

Which of the following is a specialized type of vesicle? A-Golgi complex B-Centriole C-Endoplasmic reticulum D-Lysosome E-Chloroplast

Describe and compare the use of X-rays crystallography and homology modelling to determine the structure of proteins. What are the requirements for each technique? What are the advantages and limitat...