Genetics questions and answers in April 2021

what gene associated with Bipolar disorder in reference to MIM mumber 185605 using OMIM Online Mendelian inheritance man website. what is the function this Bipolar gene disorder? please cite your sour...

What is the Ne of the Bearded Vulture population in the wild and what does this number portend for the future genetic diversity of this population and its ultimate fate?

Edited sequence: AGCGGCGGAGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGAGCTAATACCGGATAGTTCCTTGAACCGCATGGTTCAAGGATGAAAGACGGTTTCGGCTGTCACTTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAA...

4. In maize, a dominant allele A is necessary for the yellow seed color, as opposed to colorless (a). Another gene has a recessive allele w that results in waxy starch, as opposed to normal starch (W)...

Why does one need to include a negative control while performing PCR and why does this control need to be visualized using gel electrophoresis?

Please type your answer PART B: PRIMER3 SOFTWARE 1. Go to the Primer3 home page http://bioinfo.ut.ee/primer3-0.4.0/. 2. Copy and paste the human actin gamma 2 gene sequence in the box. 3. ?...

thank you for help. Q. In humans, the ability to digest lactose, the sugar in milk, declines after weaning because of decreasing levels of the enzyme lactase encoded by the LCT gene; this condition is...

c. Looking at the data below, why does it make sense regarding survival strategies and/or energy Investments that Colpoda cells get smaller (cell area) and move faster in treatment (2) compared to the...

please type your answer PART A: RETRIEVING THE HUMAN ACTIN GAMMA 2 DNA SEQUENCE 1. Go to www.ncbi.nlm.nih.gov. Click on the Genes and Expression in the left panel. Then enter BC094877.1 in the se...

Because of its effect on genetic variation, asexual reproduction is an evolutionary strategy best suited to organisms that - 1. mature very late in life and reproduce only very slowly. 2.are very mobi...

Using BLAST to Analyze Bacterial Sequence Data I am having trouble trying to edit these sequences if you can please help! I have attached the sequences, instructions on how to edit them, and the quest...

Can an offspring inherit chromosomes from only one parent? Explain

which of the following statement is true? 1) Natural selection selects against those traits of an organsim that bring it into a better adaptive relationship with its environment. 2) Natural selection ...

which of the following is not required for speciation to occur ? time niche interbreeding genetic isolation

Cleveland's Cascades allowed the outcome to Be... pick all that apply A. easily down regulated B. Rapidly scaled up C. Controlled at the level of transcription E. Tightly controlled

EXPERIMENT 5: SICKLE CELL ANEMIA INHERITANCE PATTERNS- Sickle cell anemia is a genetic disease most common in those of African ancestry that results from the mutation of a single base pair. This mutat...

cleavage cascades allow the outcome to be.... Pick all that apply a. easily down regulated b. rapidly scaled up c. controlled at the level of transcription e. tightly controlled

DNA microarrays measure the amount of mRNA for every gene that is expressed. the amount of DNA for every gene that is expressed. the amount of cDNA for every gene that is expressed. the amount of tRNA...

Consider the following correlations coefficients for the occurrence of health condition that represents a multifactorial trait: Monozygotic twins = 0.60 ?...

An artificial selection experiment is conducted in a herd of swine with a mean body weight of 300 lbs. The upper 10% of individuals are used for breeding and the mean body weight of this subset of th...

The following estimates of variance are obtained from a breeding experiment: V P = 150.0; V E = 100.0; V A = 20.0; V D = 10.0 Estimate narrow sense heritabi...

The following data are obtained for two highly inbred parental strains (P1 and P2) of a plant: (a) What variance estimates reflect environmental variance...

Cystic fibrosis (CF) is an autosomal recessive disease. Jane and John do not have CF but are worried about having a child who will have it, because John had a brother with the disease. While meeting w...

In a genetic cross for some quantitative trait, 19 distinct phenotypes are observed. Assuming that all genes contribute equally and there are no environmental effects, how many genes contribute to t...

The Lac opening is a good example of _____gene regulation

In a certain plant, height varies from 6 to 36 cm. When 6-cm plants and 36-cm plant were crossed, all F1 plants were 21 cm. In the F2 generation, a continuous range of heights wa...

Hi I need help with a Biology question. I am a grade 12 student and the chapter we are studying is molecular genetics. Question: The following diagram is of a ribosome with a mRNA attached to it, tRNA...

An F1 of the parents AABBCC x aabbcc was testcrossed to a triply recessive organism (aabbcc). If these three genes were assorting independently, how many genotypic classes would result i...

10. In cats, there is a coat color gene located on the X chromosome. This gene is a different gene from the black/Siamese gene discussed in earlier problems. This gene has two alleles—orange and bla...

Each of the orchids shown in the figure below (copied from https://dol.org/10.1016/].tplants. 2020.03.009) is a "deceptive orchid." They secrete chemicals that resemble sex pheromones of a f...

Predator-Prey Lab Lynx Populations in the Balance Background: Canadian Lynx and Snowshoe Hares In the study of the dynamics of a single population, we typically take into consideration such f...

Please explain the role that these few domains (tyrosine-kinase) play in signal transduction strategies. Please express your thoughts on how combinations of these domains contribute to both general fu...

This is all the text provided. 95.1. Which statement below about asexual reproduction is FALSE? 0 With asexual reproduction, offspring are genetically.r equivalent to the parent. Q Asexual reproductio...

Hello! I need help with this problem and will give a sum up if you help me with a detailed answer. Use driftR simulations from this link --> https://iitbiol420.shinyapps.io/driftR/ to examine the w...

CHALLENGE Although it's rare to have females with the recessive phenotype for sex-linked traits (like hemophilia and colorblindness), it does sometimes happen. Part A - How do you get a female with th...

1. How many copies would 5 cycles of PCR produce? Show how you get your answer. 2. What's considered a good primer? 3. What's the equation to calculate the Tm of a primer of 20 ba...

Please help me guys!. Laboratory Exercise # 11 Kayogram of an Aneuploid I-Objectives: 1)To produce the karyogram od a person with aneuploidy 2) To show the type of aneuploidism shown in the karyogram ...

What is the difference between hypoacetylation and hyperacetylation in terms of epigenetic function?

I need help answering these questions. No missing material

3.Imagine an STR marker that has four known alleles in a population: A, B, C, and D. Below are the alleles' relative frequencies in one population of elephants. Fill in the missing frequency for allel...

I need help editing these two sequences from Finch TV. >Sequence1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAAC...

Can someone help me create three critical thinking multiple choice questions. The first question is on Basic ch 3. Principles of Heredity such as dihybrid crosses and chi square. The second question o...

Turn on KNA-seq evidence tracks f the TSS annotation is supported by RNA-Seq read coverage or splice junction predictions e.g., TopHat, regtools), paste a Genome Browser screenshot of the region surro...

Why are incubators used for restriction enzyme digestion? What's the purpose of it?

>Sequence1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCC...

Frankenstein alludes to the possibility of, and fictitious scientific and technological breakthroughs associated with, cloning. Critics and analysts often discuss the possibility of cloning human bei...

In chipmunks, the dominant allele (H) codes for short-haired fur, and the recessive allele (h) codes for long-haired fur. What is the probability that the offspring of a cross between a male chipmunk...

please type your answer 1. How many grams of NaCl is needed to make 1 L of 1M solution? Hint: start with the molar mass of NaCl. 2. What's the equation to calculate the mass of a solute b...

En una determinada especie de plantas el color azul de la flor, (A), domina sobre el color blanco (a). ¿Cómo serán los descendientes del cruce de plantas de flores homocigóticas azules con plantas...

3. List and describe individual elements of a typical human gene based on mdm2. 4. What are two determinants that can lead to the production of isoforms for a specific locus?

answer check for the questions in the attatched picture. Which ones are right and wrong?

Please help with the following: How many chromosomes are shown in a normal human karyotype? 46 23 44 2 You are constructing a pedigree for a patient with cystic fibrosis. The individual's brother has...

I am a grade 12 biology student and the chapter we are working on is molecular genetics. Can you please help me with this question. Methylation and acetylation affect how tight or loose chromatin fibe...

Hi I am a grade 12 biology student studying molecular genetics and need help with the question below. The following base sequence on the coding strand of a DNA molecule is: AAT GCC AGT GGT TCG CAC #1a...

Vad är restriktionsenzymer ? Redogör för deras betydelse inom dagens genteknik. Redogör för fotosyntesen . I ditt svar ska förklaring av både ljusreaktionen och mörkerreaktionen finnas m...

Given your understanding about how the process of genetic modification occurs and the fear that some people have about eating GMOS, share your thoughts on whether or not GMOs are safe to consume. Wha...

Please answer all parts!!. Question 38 16 pts A purebred shorthorn breeder has an opportunity to market red, horned calves from his herd of 80 cows. As you know, shorthorns can be red (RR), roan (RW) ...

TBX1 is a DNA-binding transcription factor that is frequently mutated in the human congenital disease DiGeorge syndrome. The TBX1 protein is 398 amino acids long, and it contains a T-box DNA-binding d...

Address the PCR results (lanes 7-9). On the photograph of agarose gel, how many products did you expect in each of the two lanes, and what size (in bp or kb) did you predict the product(s) would be? D...

Please help me solve this and select one answer. Please explain how you got to the answer?. Question 9 1 pts You are interested in three linked Drosophila genes (B, R, and D) to understand their relat...

Q6. What role do the following cellular components play in the storage, expression, or transmission of genetic information: (a) chromatin, (b) nucleolus, (c) ribosome, (d) mitochondrion, (e) centriole...

Hi, can i please have some help :for the following sequence AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG i need to create a frameshift mutation by addition and one by deletion, each...

The nature of mutation This Activity session wi...

1. The following single-amino acid sequence is for a human protein. N -artkqtarks tggkaprkql atkaarksap atggvkkphr yrpgtvalre irryqkstel lirklpfqrl vreiaqdfkt dlrfqssavm alqeaseayl vglfedtnlc a...

The nature of mutation This Activity session wi...

Which of the following are biological processes associated with yellow (select all that apply)? Cuticle pigmentation Melanin biosynthesis Regulation of mRNA binding Gluconeogenesis Veined wing ext...

Hi I am a grade 12 biology student studying molecular genetics and need help with the question below. Question-3 .Compare the effect of lactose and tryptophan on their repressors. How do inducers and ...

You are working with a fragment of double-stranded DNA which you have been told has the following sequence: 5'-AGAGCTAATGCGCTAGCTAGCTAGTTCGATTATCG—3' 3'-TCTCGATTACGCGATCGATCGATCAAGCTAATAGC-5' In a s...

based on these results who are the study subjects? and what is the appropriate conclusion to make about these results based on the sample composition. Purpose To determine if prediabetes phenotype inf...

Hi I am a grade 12 biology student and we are studying molecular genetics. I am having trouble with the attached question, in particular the labeling of the diagram.. ABC Online-Assignment- Genetics (...

Six year old Zia had white patches on her belly, forehead, and in her hair since birth. Doctors determined that she had a rare genetic condition known as piebaldism. Typically when a fetus is developi...

When exploring genetics it begins cell division, chromosomes, and patterns of inheritance. The structure of cells is elaborate and complex, and most components are involved directly or indirectly with...

Humans may have Rh+ blood or Rh- blood. A person with Rh+ (R) has a certain type of protein on their erythrocytes. A person who is Rh- does not have this protein on their erythrocytes. Normal in...

Drosophila melanogaster dihybrid cross practical. Make crosses from P1 generation to F2 generation on each case. 1. Cinnabar brown female ( cn/cn; bw/ bw) × Wild type male ( cn+/cn+; bw+/bw+) 2. Wild...

Use the web to identify three drugs made using recombinant DNA technology, and list the illnesses they are used to treat.

Recombinant DNA technology is used to manufacture human growth hormone (hGH), which is used to treat some forms of dwarfism. However, "anti-gang" clinics and websites sell what they claim is hGH to he...

Using this webiste driftR (https://iitbiol420.shinyapps.io/driftR/) simulations to study the way genetic drift, selection and migration interact.keep the migration rate set to zero. Investigate how of...

In Martian squirrels, a dark tail (D) is dominant to a clear tail (d) and a short tail (S) is dominant to a long tail (s). The genes are linked. In a cross between one homozygous recessive paren...

Genes X and Y show 10% recombination, genes X and Z show 14% recombination, and genes Y and Z show 4% recombination. What is the gene arrangement that is compatible with this data?

The recombination frequency between genes A and B is 6.2 percent. How many map units apart are these genes?

Use driftR simulations to study the way genetic drift, selection and migration interact.keep the migration rate set to zero. Investigate how often the A allele is fixed or lost, and how long it takes ...

Hi I am a grade 12 student taking biology and need help with this question. The chapter is on molecular genetics. Question-1 . What matters more to how harmful a mutation is to an individual: the size...

Transcribe the following DNA sequence of HbS. DNA Sequence: 5' - AGT AAC GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC CAT - 3' mRNA Sequence: 3' - .......... - 5'

Draw a model and explain how that particular DNA mutation can be fixed using the CRISPR-Cas 9 system. Make sure you include the following components in your model and response: DNA, mutation, Cas9, RN...

To inherit Piebaldism, a person must get one mutated gene, from either the sperm or the egg that made them. This kind of inheritance is called autosomal dominant inheritance. Draw a model that sho...

How can a mutation in the gene that codes for the KIT receptor protein change the structure of this protein and how does this structural change affect how the protein functions? Include the followin...

I need the answer for this question. 4) Tom is a graduate student in a Zebrafish research lab. He recently generated transgenic fish in which the function of the gene fgf-8 is disrupted. Help Tom inte...

this is just an answer check. I just wanna know which ones are right and wrong.. What would be the complementary miNA nucleotides for the template -.ACT GCCAC?* O ACTOGGAG TOACOOTO TOUCCOTO O UGACGGUG...

help me here.. Appendix: Second Letter T C G TTT TCT TAT 1 TGT TTC Phe TOC TAC Ty TOC Cys T TTA TTG Lou TCA TAA Stop TGA Stop TOG TAG Stop TGG Tip CTT COT CAT CGT CTC CCC CAC His C CGC Arg CTA Leu CCA...

In pea plants, the genes for flower colour and pollen shape are located on the same chromosome. Purple flowers (A) are known to be dominant to white (a), and long pollen (B) is known to be dominant to...

Please transcribe the following DNA sequence from HbA to the mRNA sequence below. DNA sequence: 5' - AGT AAC GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC CAT - 3' mRNA Sequence: 3' - .........................

Draw a linear map of the fruit fly chromosome showing the relative placement of all four genes in the correct order. Represent the chromosome with a horizontal line and the gene positions with a verti...

Calculate the recombination frequency between each pair of genes studied. Then, make a properly formatted and labeled table that shows these values and show your work on how the recombination frequenc...

For each of the above 5 listed crosses, write the phenotype of each parent fly in the spaces provided below for each cross.. The following crosses were performed, and the data indicated were collected...

In guinea pigs the allele for black (B) is dominant to the allele for white. The allele for short hair (S) is dominant to the allele for long hair (s). a) A heterozygous black and short-haired male gu...

part 2 of 2 for question 22. Summers "eventually apologized for his remarks" (http:l/www.cnn.com/2005/EDUCATION/01/20/harvard.summers.ap/). Using all your knowledge about what you have been taught...

Can I please have help with these questions?. Part One — Fruit Weight in Oranges Inbred X inbred Y P1 24 g 32 9 F1 28 9 F2 No. of Plants Weight (g) 3 36 23 34 85 32 169 30 215 28 183 26 92 24 27 22 ...

if danny ever has a son with a woman who does not carry a gene for hypertrichosis what is the probability of that child having hypertrichosis

Question: based on the following information, answer the questions that follow case study ; The three fundamental snags are thusly: the little size required for the recieving wire, the trouble in f...

Question: subject this information below to analysis and use it to answer the questions CASE STUDY To clean hard surfaces that have the skunk smell, splash on a cleaning arrangement that contains dy...

Question 5: Sex linked diseases Hemophilia is a serious disease carried on the X chromosome. The gene H is recessive so if the female has one non-H gene and one H gene , the gene will not be exp...

a. What are the four phenotypes in the ABO blood system?

a. What are the six genotypes in the ABO blood system?

Please answer all multiple choices. There should only be one answer for the first one. Last attempt. Thank you and God bless. 1. Using microarrays to identify genes involved in cancer Almost all cance...

Options for #1 ("To create the appropriate recombinant plasmid...") - "restriction fragment" , "vector" , "DNA prob" Options for #2 ("Isolate___DNA from the cheek....") - "vector" , "genomic" Options ...

The E. Coli cells used in this experiment are genetically engineered to be "T7 expression hosts". This means these cells can express T7 polymerase, under control of the lac promotor, and an additiona...

44. Consider a situation in which an insecticide-resistance gene in the house fly Mustica domesticu, (R), is dominant to the nonresistance coding allele (r). Suppose that a new insecticide spraying pr...

What is the gene associated with Alzheimer disease? what are the function of this Alzheimer gene? please cite your source/sources

I need help with the Geniverse Case 10 Exam 1 and answers:. Apprentice Certification Exam | Welcome to Geniverse, John Member #1, Group #1 edit L ? Female Drake Male Drake Breed steel charcoal Long ta...

Planck's hypothesis of light emission, like the classical explanation, stated that objects emit light through the accelerated motion of electrically charged particles. What in Planck's hypothesis brou...

Explain the hypothesis suggested by Sussman in 1991 cited as the reason primates took to arboreal living as an adaptive niche.

In a few sentences describe the general process cells use to copy their DNA.

libs 1940. When we talk about a zombie apocalypse, we are rehearsing which of the following crises? An epidemic. A nuclear apocolypse. All of the crises mentioned. A life or death decision for another...

In the Wolf, Moose, and Fir case, The data from the case demonstrated that from 1980-1994 there was no significant change in AET (nutrient availability for primary productivity), however fir numbers ...

If the chances of having one STR (single-tandem repeat) is 1/2 and the chances of having a second one is 1/900. Then what are the chances of having both? Select one: a. 1:200 b. 1:2000 c. 1:900 d. 1:1...

Which of the following DNA fragments will travel the furthest in a gel electrophoresis analysis? a 1000 bp b. 101 bp c. 300 bp d. 100 bp

Natural Selection Simulation at PHET http://phet.colorado.edu/simulations/sims.php?sim=Natural_Selection (biol.co/2wolf2

In your own knowledge, Explain the three law of inheritance of Mendel and how it was helpful on discovering the genetic transfer of the characteristics from the parents to the offspring.

Suppose that parent-offspring similarity for tarsus length is studied in two geographically distinct sparrow populations. In the first population, the average tarsus length is 2 cm and h2 = 0.6; in th...

Some human Y-chromosomes contain a gene for a trait called hairy pinna, which produces massive hair growth on the outer ear. Since the corresponding gene is not found on the X-chromosome, which statem...

Tracey has a blood type of AB and so does her husband Trevor. What are the possible blood types of there children

In the family as shown in Figure 9, individual IV 1 died shortly after birth with the very rare disease SCID which was caused by complete deficiency of the enzyme ADA. His aunt III 3 is married to her...

You are working for a pharmaceutical company are are tasked with creating E. Coli that express an influenza antigen (a protein that is recognized by our immune system) for treatment of the influenza v...

In the family as shown in Figure 9, individual IV1died shortly after birth with the very rare disease SCID which was caused by complete deficiency of the enzyme ADA. His aunt III3 is married to her co...

In certain breeds of dogs two different sets of alleles determine the color pattern. Black color is dominate and red color is recessive; solid color is dominate and white spotting is recessive. A ...

Humans may have Rh+ blood or Rh- blood. A person with Rh+ (R) has a certain type of protein on their erythrocytes. A person who is Rh- does not have this protein on their erythrocytes. Normal in...

In horses, black fur color (B) is dominate to chestnut fur color (b). Trotting gait (T) is dominate to pacing gait (t). A cross is made between a horse that is homozygous for both black fur and ...

A red bull, when crossed with white cows, always produces roan-colored offspring. Explain how the colors for red, white, and roan are inherited.

In horses, black fur color (B) is dominate to chestnut fur color (b). Trotting gait (T) is dominate to pacing gait (t). A cross is made between a horse that is homozygous for both black fur and th...

Humans may have Rh+ blood or Rh- blood. A person with Rh+ (R) has a certain type of protein on their erythrocytes. A person who is Rh- does not have this protein on their erythrocytes. Normal in...

In certain breeds of dogs two different sets of alleles determine the color pattern. Black color is dominate and red color is recessive; solid color is dominate and white spotting is recessive. A ...

Compare and contrast the Following mechanisms. How does each odeviate From simple mendelian inheritance? - maternal inheritance - Genomic imprinting - trinucleotide repeats disease.

A woman who is a carrier for hemophilia marries a man with hemophilia. Could any of their children have hemophilia? If so, would the child be male or female?

A woman who is heterozygous for hemophilia marries a normal male. What are the possible phenotypes of their children?

Please be specific and clear as much as possible. Please give explanations of how novel characters can evolve in terms of evolutionary developmental biology. Think about how novel morphological featur...

A mouse that is homozygous for both traits of brown eye colour and dominant long tail length, is crossed with one that is homozygous for the recessive blue eye colour and short tail length. Solve this...

Jane the hitchhiker has hitchhiker's thumb and a pure genotype. Hitchhiker's thumb is dominant. She married Howard the heterozygote. Solve the Punnett square and answer the following: What is Howard's...

Some animals have special appearances and structures that allow them to blend in with their environment or make them look like something else. The images below are of different insects; a walking stic...

What are the 3 types of bacterial gene exchange? Briefly describe how each works. Why would the ability to take in foreign DNA be beneficial to the organism?

Please help me answer this human genetics question. Cells require compound T for survival. There are other precursor compounds that are involved in the pathway, your job is to analyze the data, and pu...

1) How many chromosomes were in the egg cell? Select one: a. 22 b. 47 c. 24 d. 23 2) The giant panda has a diploid number of 42, which includes a pair of sex chromosomes that is analogous to human...

I need your help with this question. Be specific as possible. -Many human genomes contain traces of Neanderthal ancestry. However, the autosomes of non-Africans contain approximately five times as m...

A true-breeding mouse P1 with red fur and long hair is crossed to another true-breeding mouse P2 with brown fur and short hair. Let R refer to the gene that controls fur color and L refer to the gene ...

Many organisms have unusual behaviors or characteristics when compared to similar organisms. For example, spiders are known for being almost completely carnivorous. They've evolved to have fangs and v...

Could you please help me solve the following question?. You randomly sample a population of this ﬂower species. After sampling you find 12? red ﬂowers. 4? pink ﬂowers. and 1'43 white ﬂowers. o...

Could you please help me solve the following question?. A flower expresses petal size with a dominate/ recessive gene where the dominant allele (P) results in large petal size and the recessive allele...

I asked this question yesterday and received an answer that confused me, broken down into "case one" and "case two". I followed up, but haven't gotten a response. I didn't understand how this question...

some help please!. 4. In humans, ABO blood groups are determined by an autosomal gene. Hemophilia is an X-linked recessive disorder, where H is the normal allele and h is the hemophilia allele. Suppos...

Could you please help me solve the following question?. Q10. Which of the following must exist in a population before natural selection can act upon that population? a. Multiple chromosomes b. Multice...

Could you please help me solve the following question?. Q9. Which is not one of Darwin's observations from nature that form the foundation of his theory? a. The strongest individuals will be those t...

Could you please help me solve the following question?. Q8. What is true of the following pedigree? I Male D 0 Female Carrier of recessive . This is an autosomal dominant disease . This is a sex-linke...

Could you please help me solve the following question?. Q7. What is true of dominant and recessive alleles? a. Dominant alleles are always more abundant than recessive alleles b. Dominant alleles stro...

Could you please help me solve the following question?. Q6. What statement best summarizes what early humans (at the dawn of agriculture) correctly knew about heredity? a. That hereditary information ...

Could you please help me solve the following question?. Q5. Select the correct sequence of the process of evolution, in chronological order: a. A mutation occurs in a gene, the individual with that mu...

Could you please help me solve the following question?. A flower expresses petal size with a dominate] recessive gene where the dominant allele (P) results in large petal size and the recessive allele...

Please show all work and explanation. Thank you. We wish to improve yearling weight (YW) in our cow herd. Calculate: hz for YW = -35 0 Overall selection intensity herd mean for Yw = 875 lb 0 Response ...

Diabetes has been found to be inherited (in some cases) through a recessive allele (d). What is the possible genotypes for the offspring of a heterozygous father and a diabetic mother?

X-linked recessive and Y-linked genetic diseases in humans are similar in that males tend to be affected and show the diseased phenotype. Describe a scenario (for example a pedigree) that would allow ...

I really need answers .. B. After moving the centrosomes, drag the pairs of homologous chromosomes together. Click on a chromosome. What happens? When homologous chromosomes are paired up, they can ex...

I need help asap for answers. A. Proceed though meiosis to anaphase I. Which chromosomes went up and which went down? Up: Down: B. Click Back and run anaphase I again a few times. Did the results ever...

Which of the following do you think is the most important stage in early fruit fly development and what evidence supports this choice? 1. Maternal Gradient mRNA: transcription of Mom's genes & mRN...

1. You work in a lab that wants to test the prediction that mice which receive vitamin supplements at a young age will live to older ages than those fed on mother's milk alone. Your team collects data...

Biology 6 Lecture Exercise 18 Mutation Given the same segment of a template DNA strand from the previous lecture exercise , illustrate effects of various kinds of mutations on transcription and tra...

If possible, i would appreciate having the answer in an interval of 3 hours so i can study it before a test. Thank you! Large quantities of the antibody Y can defend our organism from the invasion by ...

I need to have the answer before 6:30 PM if possible so i can study it. Thank you! You hypothesize that the different cell types of an animal organism contain the same genome. To test your hypothesis,...

Triton X-100 was used to solubilize several membrane proteins from a biological membrane. These proteins were then reconstituted in artificial phospholipid vesicles. During the reconstitution, the hyd...

Inside pic. Bacterial resistance to fluoroquinolone antibiotics can arise This can cause O through mutations in genes that code for helicases; reduced affinity of helicases for fluoroquinolones O thro...

in picture. Most DNA polymerases have activity for but does not. ( 3' to 5' exonuclease activity; primer removal; reverse transcriptase 3' to 5' exonuclease activity; proofreading; reverse transcripta...

info in pic I. Hershey 8: Chase experiments: The treatment with labeled DNA has 55% of the label in the pellet and 35% in the supernatant. Why is some of the label in the supernatant? [:1 phage protei...

info in pic. A small chi square value indicates little difference between and expected values and a probability that chance alone can explain those differences. O theoretical; low O theoretical; high ...

all info in pic. If a red flowered 4 o'clock plant is crossed with a white flowered 4 o'clock plant, what color flowers will the offspring have? This is an example of pink; co-dominance O pink; incomp...

all info in pic. If two heterozygous black labs are crossed what is the phenotypic ratio of the offspring? {j 913:3:1 hlacl: to yellow to chocolate to white {3 9:3:4 black to chocolate to yellow {3 3:...

All info in pic. Suppose we have two pea plants with the following genotypes. Aa Bi: :1 ha Bl: What proportion of their offspring will he homozygous dominant in at least one gene. (3 T115 c) 3:15 {3 9...

All info in pic. The gene or genes present in the genome of the hair cells of a white patch is/are O S 0 all of the answers shown are correct 0 Kb 0 KB. The gene or genes present in the genome of the ...

please answer me the question. Personhood A Thought Experiment A clinic that performs in vitro fertilization is burning rapidly. You rush into the building and find two rooms. One contains a canister ...

all info in picture. I - 1 O 1-2 II - 1 On-2 II - 3 O II - 4 II - 5 III - 1 III - 2 III - 3 IV - 1 This is a pedigree for an X-linked recessive disease. What is the genotype of individual II-2? O XHxh...

A: Find the transmembrane domain on all of the isoforms of NRG 1, NRG 2, NRG 3, and NRG 4. B: create FASTA files (format) for each cDNA and Protein Sequence for: extracellular domain, extracellular d...

Please help me! Thank you so much!. H 2 = Huntington's Disease II 2 4 3 8 III 5 1. Which members of the family above are afflicted with Huntington's Disease? 2. There are no carriers for Huntington's ...

19Which of the following statements is NOT true for DNA replication? Question 19 options: A) the enzyme DNA polymerase checks for errors in base pairing B) each strand acts as a template for the s...

B. Consider the template strand and the synthesized strand. In one clear sentence, describe why this sequence might serve as a restriction site. C. What is the probability of random occurrence of such...

Answer and explain the following questions.. Q. In humans, the ability to digest lactose, the sugar in milk, declines after weaning because of decreasing levels of the enzyme lactase encoded by the LC...

What is the expected percentage of wild type females in the progeny?. In D. melanogaster, ebony body (e) and rough eyes (m) are encoded by autosomal recessive genes found on chromosome 3: they are sep...

A pure breeding strain for the tiny mutation in Tribolium sp. cannot produce wild type eyes. The tiny gene is almost identical to the eyeless gene in Drosophilia melanogaster. Explain how the tiny mut...

Identify the type of mutation (sense, missense, or nonsense) that occurred in the following gene based on the type of mutation listed. 2nd base in codon U C A G Phe Ser Tyr Cys U Phe Ser Tyr Cys Lou S...

A chromosome has the following segments, where * represents the centromere: TUV*WXYZ What types of chromosome mutations are required to change this chromosome into each of the following chromosomes? (...

6 different pure breeding mutant strains (a,b,c,d,e, and that each exhibits white flower color have been established in the diploid Malva sylvestris plant (Mystic Merlin cultivar). A complementation t...

Please answer multiple choice Option for " HEXA disease-causing mRNA transcript" - "TTT" , "TTG" , "AAA" , "UUU" Options for "Wild-type HEXA polypeptide" - "Phe" , "Val" Options for "Disease-cau...

Restriction mapping was performed in a 8-kb region around the flower size locus in the diploid Malva sylvestris plant using BamHI (B), Sall (S), and Hindill n (H). A restriction map for this 8-kb line...

arked out of In the diploid Malva sylvestris plant, locus A determines flower size (A = large, Flag a = small) and locus B determines petal shape (B = rounded, b = pointed). estion Studies were conduc...

1. I need help making 10 practice problems, using any of the traits. These should be word problems . Do not just write Aa x Aa.Must include at least one pedigree and 1 dihybrid qu...

In orcs, an allelic series helps to determine the structures of the lower jaw: C (Large fangs with an underbite), clar (Large fangs with no underbite), cam (Small fangs with no underbite), and c (No f...

Based on the patterns of inheritance that you see among the offspring, describe which guinea pig traits (color: black or brown, coat: smooth or rough, and eyes: dark or pink) appear to be recessive an...

Hi Tutor, please help me with the following questions. I don't need long explanations. Straight to the point is fine. Thank you and have a great day.. QUESTION 4 Which sequence, molecule or enzyme is ...

Hi Tutor, please help me on the following questions. Long explanations aren't need. Straight to the point is fine. Thank you and have a great day.. QUESTION 1 Which choice below describes the post-tra...