This question has been answered
Question

A scientist is wanting to discover the Kd (equilibrium dissociation

constant) for the interaction between a protein (YFP) and an RNA molecule (RO1) that folds the stem-loop when it binds to the protein.


The sequence of RO1 is:
5' - CCUUGAUAGUUAUUGCGGAAGGGGCAAUAACUAAUCAAGG - 3'
(a) Use a diagram of the secondary structure, like the roadkill map, to determine the loop structure that forms when the oligonucleotide RO1 is folded. Be sure to indicate the 5' and 3' ends and the base pairings in the drawing.
(b) As the protein is absent, the RO1 molecule can form an intermolecular complex that contains 2 RO1 molecules when the concentration is high. Which structure would you expect to see from the described intermolecular complex? Draw the structure.
(c) RNA can be labelled by using an enzyme (nucleotide kinase) to catalyze the transfer of the phosphate that contains the radioactive isotope of the phosphorus 32P from ATP to the 3' OH of the RNA molecule. Initially, the scientist wanted to label the RNA molecule with this method, however, he added sodium hydroxide to the solution containing RO1 and it hydrolyzes to its component monomers. Draw the chemical structure of the nucleotide that contains the isotope after the hydrolysis with the position. Remember to show all of the bonds.

Answered by Expert Tutors
Step-by-step explanation
3 Attachments
intermolecular complex structure.PNG
PNG
RNA degradation, labelling, and structure of nucleotide.PNG
PNG
Roadkill map.PNG
PNG
A scientist is wanting to discover the Kd (equilibrium dissociation constant) for the interaction between a protein (YFP) and an RNA molecule (RO1)...
Get unstuck

321,403 students got unstuck by Course
Hero in the last week

step by step solutions

Our Expert Tutors provide step by step solutions to help you excel in your courses