This question has been answered
Question

Dr. Bicardi is wanting to discover the Kd (equilibrium dissociation

constant) for the interaction between a protein (YFP) and an RNA molecule (RO1) that folds the stem-loop when it binds to the protein.
The sequence of RO1 is:
5' - CCUUGAUAGUUAUUGCGGAAGGGGCAAUAACUAAUCAAGG - 3'


(A) RNA can be labeled by using an enzyme (nucleotide kinase) to catalyze the transfer of the phosphate that contains the radioactive isotope of the phosphorus 32P from ATP to the 3' OH of the RNA molecule. Initially, the scientist wanted to label the RNA molecule with this method, however, he added sodium hydroxide to the solution containing RO1 and it hydrolyzes to its component monomers. Draw the chemical structure of the nucleotide that contains the isotope after the hydrolysis with the position. Remember to show all of the bonds.

Answered by Expert Tutors
Step-by-step explanation
1 Attachment
RO1 and hydrolysis.jpg
jpg
Bicardi is wanting to discover the Kd (equilibrium dissociation constant) for the interaction between a protein (YFP) and an RNA molecule (RO1) that...
Get unstuck

378,310 students got unstuck by Course
Hero in the last week

step by step solutions

Our Expert Tutors provide step by step solutions to help you excel in your courses