View the step-by-step solution to:

Your task is to design the 5' oligonucleotide used to amplify GFP in order to obtain the correct PCR product to clone into pSK (assume you have the...

 

Your task is to design the 5' oligonucleotide used to amplify GFP in order to obtain the correct PCR product to clone into pSK (assume you have the 3' oligonucleotide available). Your 5' oligonucleotide needs a XhoI site, which, after restriction, will produce an overhang that can be ligated in frame into the pSK vector.

 

You will need to write down the sequence of your 5' oligonucleotide as follows:

 

1) the restriction site (6 nucleotides)

2) any nucleotide you may find necessary to include to preserve the frame (0,1 or 2 nucleotides)

3) 5 codons corresponding to the relevant GFP coding sequence, starting from the second codon of GFP (15 nucleotides).

 

This will make a sequence of 21 nucleotides, plus 1 or 2 nt if you decide to add them to your sequence in order to preserve the frame. As a side note: 4-6 nucleotides are usually added to the 5' end in order to provide enough space for the enzyme to cut- we won't worry about this here.

 

the following information:

 

•XhoI restriction site:  CTCGAG

 

 

•The 5' end of the GFP coding sequence (start codon is underlined):

 

5' ATG AGT AAA GGA GAA GAA CTT TT CACTGGAGT TGTCCCAATT CTTGTTGAAT TAGATGGTGA TGTTAATGGGCACAAATTTT CTGTCAGTGG AGAGGGTGAA GGTGATGCAA CATACGGAAA ACTTACCCTT 3'

 

 

•The sequence of LacZa on the vector, including the start codon (underlined) and the XhoI site:

 


 

 

 

•Clearly indicate the sequence of your oligonucleotide, 5' to 3', as per the instructions above. Add your sequence to the nucleotides written below. These four nucleotides are added to the 5' end of your primer in order to allow for efficient cutting by the XhoI enzyme close to the end of your oligonucleotide.

 

[ optional: For more information on this, go to this link:

https://www.neb.com/tools-and-resources/usage-guidelines/cleavage-close-to-the-end-of-dna-fragments ]

 

 

5' A T G A ...

 

 

On your sequence:

 

-         underline the XhoI site

 

-         


indicate the codons with brackets : AGT ...

 

-         state clearly whether or not you are adding nucleotide(s), and if you do, circle it (them).

 

-         indicate the predicted amino acids (3 letter code) produced at the fusion point: start with the LacZa residues Ser-Ile-Pro and continue from there into your GFP sequence indicating the 5 residues encoded from the GFP coding sequence.

 

 

 

 

 

 

 

 

 

 

 

Recently Asked Questions

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

-

Educational Resources
  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question