View the step-by-step solution to:

Question

Hello tutors,

could you please help me?



Write a brief outline of the

mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells


Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease. 


Finally - using the codon table below, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand - comment on how this has affected the resulting peptide chain.

 

  • aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
  • aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc










Please tell me the references too,

Thank you.

Top Answer

In eukaryotes, the DNA is transcripted in mRNA in the nucleus, then is translated in protein by the ribosome in the... View the full answer

Sign up to view the full answer

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question