Question Get Answer

1) how CRISPR as a gene-editing technology connects to the mechanism of protein synthesis


2)  5' GCGCCCTATATAAGCTACGCTCCCTTTGAAGAGTATATCGCCGTAGCTAGAC 3'

For the template strand above the promoter region is 7 nucleotides long and termination is the end of the strand. 

a) What is the primary transcript for this sequence?

b) Assuming there are no introns in the transcript, what are the post-transcriptional modifications would occur.

c) Finally translate the final transcript into its associated polypeptide and EXPLAIN exactly HOW this occurred, include at least 8 steps?

Subject: Biology, Science

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question
Let our 24/7 Biology tutors help you get unstuck! Ask your first question.
A+ icon
Ask Expert Tutors You can ask You can ask You can ask (will expire )
Answers in as fast as 15 minutes