View the step-by-step solution to:

Two sequence are shown below: (i) a representation of the cloning site of the vector, and (ii) The start and the end of the gene. The start and stop...

PLEASE EXPLAIN THE FACTOR TAKEN INTO CONSIDERATION WHEN GIVING SOLUTION TO EACH QUESTION (A-D).
NOTE: ATTACHED IS A WORD DOCUMENT CONTAINING THE DATA OF THE QUESTIONS. BECAUSE THE CODONS KEPT OVERLAPPING WHEN I TRY TO PASTE THEM TO THE QUESTION BOX ON THE COURSE HERO WEBSITE, SO I HAD TO ATTACH THE ENTIRE WORLD DOCUMENT. I HOPE THIS IS O.K.
1. Two sequence are shown below: (i) a representation of the cloning site of the vector, and (ii) The start and the end of the gene. The start and stop codons are indicated in bold type. (i) Vector cloning site T TGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAAT TTCACAC AGGAAACAGAGCGCT ATG CATCACCACCATCACCATAATATTTAGTGATAGTGA TTATAATA GTAGTGATGAGAGCTCCGTCGCCGTCGCCGT TAA GGCTGTTTTGGCGGATGAG AGAAGATTT TCAGCCTGATACAGATTAAATCAGAACGCAGAAG (II) Gene: ATG AAGATCGACACGTGCGTCCTG (…) GCTCCGGCTCCTGTTGCTACG TAA Two combinations of blunt-cutiing restriction enzyme sites are highlighted. One combination is highlighted yellow, the other is highlighted green. Using either combination of sites as starting point, write out a pair of primers (forward and reverse) for PCR amplification of the gene to be cloned into the vector by LIC. Do not concern yourself with potential secondary structure. Describe the rationale for your primer designs, including reasons for your choice of parameter, and outline the LIC cloning method. 2. within the DNA sequence shown below, is a gene with restriction sites proximal to its start and stop codons. The 6base restriction sites have overhangs (underlined ) respectively compatible with those listed as the cloning site of a vector. 1 TTAAAATGTA AATTATATTA AAATCGGTAT AATAGAAAGA GAGAATTTAA ATTGGGAATA 61 TACAAGTAAT ACAAAAATTA GGAGGAATTT CCC ATG CCTA TTAAAATTAA TCTTCCCAGC 121 ATGAAAAACA CCGCTGATAC ATGGTCGCTT GATGTTTTAC GGCATGGTAC TGTATACCGC 181 AATTTAAAAG ATAATAATTG TTATATTTAT CAAAATGAAC TAAACGGGCA TATTTATATA 241 ATTGAGTCCG GCGATTTTTA TTCTTTTGAA AATGAGTATG AAGCGAAAGA CCATTTACAG 301 GAAAATGATA TTCCTGACGT ATGGAAAGAA ACAAATCTCG CTTTTGTTGT AAGTCTTGAA 361 GCTAGCAAA T AG ATCTAAAT ATTAGTGTAT AGGAATATTC CTATACACTA ATAA Vector sites: AatII (GACGT C), BglII (AGATC T), BspHI (TCATG A), MfeI (CAATT G), NdeI (CATA TG), NheI (GCTAG C), XbaI (TCTAG A)
Background image of page 1
a). The start and the stop codons are showed in bold type : note the sequence of the proximal restriction sites, referred to previously, and then in your answer booklet write out the sequence you have identified, one 6 letter sequence per line. b). what is the length of the gene including flanking restriction sites, from the first base of the site by the start codon to the last base of the site by the stop codon? c). The gen and vector are ligated at their annealed restriction site overhangs. Of the listed enzymes, decide if any could re-cleave each of the ligated ends: if so, name the enzyme(s) and explain why. And if not, then explain why not. d). Describe how you would select potential colonies from the transformation, and what laboratory methods you could use to determine whether these colonies have your gene cloned directly.
Background image of page 2
Sign up to view the entire interaction

Top Answer

We can only answer your free 3 questions one at a time. You have two options to get your questions answered:... View the full answer

Sign up to view the full answer

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

-

Educational Resources
  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question
Ask a homework question - tutors are online