View the step-by-step solution to:

The two lines below are a segment of double stranded DNA. First transcribe the DNA into RNA then translate it into a protein. Remember the...

The two lines below are a segment of double stranded DNA. First transcribe the DNA into RNA then translate it into a protein. Remember the differences between DNA and RNA when transcribing. Use your codon table for the translation. Pay attention to where to start translation.





G A T A C A G T G G G C T G T A C T T T T A G G T A A T T
C T A T G T C A C C C G A C A T G A A A A T C C A T T A A


Sign up to view the entire interaction

Top Answer

Dear Student Please find... View the full answer

Biology-8093218.doc

Answer
Any strand of DNA may work for the purpose of RNA synthesis and RNA synthesized by it will
consist of complementary sequence hence; if we take the strand:
GATACAGTGGGCTGTACTTTTAGGTAATT
Then,...

Sign up to view the full answer

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

-

Educational Resources
  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question
Ask a homework question - tutors are online