This question has been answered
Question

Biochemistry Question

Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. You can consult the bioinformatics exercise “Project 1: Databases for the Storage and ‘Mining’ of Genome Sequences” (ATTACHED). The procedure to identify the gene and the protein that it encodes is as follows:

** Look carefully at the DNA sequence provided (ATTACHED Q_10_i_dna_sequence.pdf), and identify the start site for transcription. **

Click on the DNA sequence from the start site of transcription and select all of the sequence and copy the sequence.

Go to the National Center for Biotechnology Information website http://www.ncbi.nlm.nih.gov/ and click on BLAST on the right hand side under “Popular Resources”. BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx on the left hand column under the title “Basic Blast”.
Paste the DNA sequence into the box and click BLAST!. The search may take a few seconds and the page will keep updating until the search is completed.

When the search is complete you will have a figure showing the most homologous results or “sequences producing significant alignments” and following that, a list of what these proteins are. Your protein will be the first one on the list. You can click on the left hand side on the accession number or sequence identifier information which will bring up more information. You should be able to find the name, function, size (number of amino acids) and source (name of the organism) for the protein.

Your answer should include the:
1.Amino acid sequence of the protein
2.Size of the protein
3. Identity of the protein
4. Function of the protein

2 Attachments
Bioinformatics Exercises Over the last two decades, information has been gaining increasing importance in both teaching and learning biochemistry. The most obvious case is the sequencing of the human genome and many other complete genomes. In 1990, the determination of the sequence of a protein was often the topic of a full publication in a peer-reviewed journal such as Science, Nature, or The Journal of Biological Chemistry. Now entire genomes are the topic of individual research papers. The term "bioinformatics" is a catch-all phrase which generally refers to the use computers and computer science approaches to the study of biological systems. The main chapters where this information is discussed in the text are chapters 3 (Nucleotides, Nucleic Acids and Genetic Information), 5 (Proteins: Primary Structure), 6 (Proteins: Three- Dimensional Structure), 12 (Enzyme Kinetics, Inhibition and Regulation) and 13 (Introduction to Metabolism). Here we provide exercises appropriate to these chapters aimed at introducing the techniques of bioinformatics that involve the use of computers, Internet-accessible databases and the tools that have been developed to “mine” those databases. General principles 1. Open ended questions . The exercises may include some questions that have deFnite answers, but in many cases there will also be questions which may be answered in a number of ways, depending on the approach you take or the topic you select. 2. Stable Internet Resources . As much as possible, the exercises will be based on well established, stable web sites. If it is necessary to use less reliable sites and/or resources, attempts have been made to provide multiple sites that perform similar functions. 3. Here are the stable online resources that will be used most frequently: a. Genbank (//www.ncbi.nlm.nih.gov/) b. Protein Data Bank (http://www.rcsb.org) c. Expasy Proteomics Server (http://us.expasy.org/)
Background image of page 1
d. European Bioinformatics Institute (//www.ebi.ac.uk/) e. Pfam (//www.sanger.ac.uk/Software/Pfam/) f. SCOP (http://scop.mrc-lmb.cam.ac.uk/scop/) g. CATH (http://www.biochem.ucl.ac.uk/bsm/cath/) h. PubMed (//www.ncbi.nlm.nih.gov/entrez/query.fcgi) i. PubMed Central (http://www.pubmedcentral.nih.gov/) 4. Answer key . Where a deFnite answer is known, it will be provided in an answer key. ±or more open-ended questions, a typical correct answer will be presented. 5. Historical perspective . If historical resources are available online (including PubMed), there may be questions designed to help students identify some of the historical roots of biochemistry and molecular biology. Project 1: Databases for the Storage and “Mining” of Genome Sequences Chapter 3 is an introduction to nucleotides, nucleic acids (DNA and RNA), and the processes of transcription and translation. 1. Finding Databases. One of the major bioinformatics tools is the biological database. These databases are an important resource for the study of biochemistry at all levels. These databases contain huge amounts of information about the sequence and structure of nucleic acids (DNA and RNA) and proteins. They also contain software tools that can be used to analyze the data. Some of the software you can use directly from a web browser - these tools are called web applications. Other software must be downloaded and installed on your local computer - these are called freestanding applications. We'll start with fnding databases a. What major databases are available online that contain DNA and protein sequences? b. Which database contains entire genomes? c. Using your textbook and online resources (http://www.google.com), make sure you understand the meaning of the following terms. i. BLAST
Background image of page 2

End of preview

AGACAGACGCATCGCTTCAAGGAGAAACAACATGATCCCAGTAATCCTTTCCGGTGGCAGCGGCTCGCGA CTCTGGCCTCTTTCCCGCAAGCAGTACCCCAAGCAGTTCCTCGCCCTCACCGGCGACGACACCCTGTTCC AGCAGACCATCAAGCGCCTGGCCTTCGACGGCATGCAGGCACCGCTGCTGGTGTGCAACAAGGAGCACCG CTTCATCGTCCAGGAACAGCTGGAGGCACAGAACCTGGCGAGCCAGGCGATCCTCCTCGAACCCTTCGGC CGCAACACGGCGCCGGCGGTGGCCATCGCCGCGATGAAACTGGTCGCCGAAGGCCGCGACGAACTGCTGC TGATCCTTCCCGCCGACCACGTGATCGAGGACCAGCGCGCCTTCCAGCAGGCCCTGGCGCTGGCCACCAA CGCCGCCGAAAAGGGCGAGATGGTGCTCTTCGGCATTCCCGCCAGCCGCCCCGAGACCGGCTACGGCTAC ATCCGCGCGAGCGCCGATGCGCAACTGCCGGAAGGCGTCAGCCGGGTGCAGAGCTTCGTCGAGAAGCCCG ACGAAGCCCGCGCCCGCGAGTTCGTCGCCGCCGGCGGCTACTACTGGAACAGCGGCATGTTCCTGTTCCG CGCCAGCCGCTACCTGGAAGAACTGAAGAAGCACGACGCCGACATCTACGACACCTGCCTGCTGGCCCTG GAGCGCAGCCAGCACGACGGCGACCTGGTGAACATCGACGCCGCCACCTTCGAATGCTGCCCGGACAACT CCATCGACTACGCGGTGATGGAGAAGACCTCACGCGCCTGCGTGGTGCCGCTGTCCGCCGGCTGGAACGA TGTCGGCAGCTGGTCGTCGATCTGGGACGTGCACGCCAAGGACGCCAACGGCAACGTCACCAAGGGCGAC GTGCTGGTCCACGACAGCCACAACTGCCTGGTGCACGGCAACGGCAAGCTGGTCTCGGTGATCGGCCTGG AGGACATCGTGGTGGTGGAAACCAAGGACGCCATGATGATCGCCCACAAGGACCGGGTGCAGGACGTCAA GCACGTGGTCAAGGACCTCGACGCCCAGGGCCGCAGCGAGACCCAGAACCACTGCGAGGTCTACCGCCCG TGGGGCTCCTACGACTCGGTGGACATGGGCGGCCGCTTCCAGGTCAAGCACATCACCGTGAAGCCCGGCG CGCGCCTCTCGCTGCAGATGCACCACCACCGCGCCGAGCACTGGATCGTGGTTTCCGGGACCGCCCAGGT GACCTGCGACGACAAGACCTTCCTGCTCACCGAGAACCAGTCGACCTACATCCCGATCGCCTCCGTGCAC CGCCTGGCCAACCCCGGCAAGATCCCGCTGGAGATCATCGAGGTGCAGTCCGGCAGCTACCTCGGCGAGG ACGACATCGAGCGCCTGGAAGACGTCTACGGGCGCACCGCAGAACCGGCCCTGCAAGTGGTCGCCGGCAG CCGCTGA
Background image of page 1
Answered by Expert Tutors
Subject: Biology, Science
Bioinformatics Exercises Over the last two decades, information has been gaining increasing importance in both teaching and learning biochemistry....
Get unstuck

277,629 students got unstuck by Course
Hero in the last week

step by step solutions

Our Expert Tutors provide step by step solutions to help you excel in your courses