View the step-by-step solution to:

Question

Please answer questions an below, highlight your primers. thank you.

alt="10753971" />

attachment_10142019.png

Biol 410 Practice Problems
Module 3 Exercise
Polymerase Chain Reaction
1. In FASTA format, give a forward and reverse flanking primer that will amplify the gene sequence
in bold:
TCAAATGTTTACAGACACTATTAATAAGTGTGCGGCTAACGCTGCGCGCATTGCACGCCTG
TCGGCAAATAACCCGCTCGGCTTTTGGGTCAGCTCCGCCATGGCGGGCGCGTATGTGGGT
CTTGGGATCATCCTGATTTTCACGCTCGGTAATTTGCTCGATCCATCCGTACGCCCTTTGG
TGATGGGCGCGACCTTTGGTATCGCCTTAACGCTGGTGATTATCGCCGGTTCTGAACTGTT
CACCGGACACACCATGTTCCTCACCTTTGGGGTAAAAGCGGGCAGCATCAGCCACGGGCA
AATGTGGGCAATCCTGCCGCAAACCTGGCTGGGTAACCTGGTCGGTTCCGTCTTCGTTGC
CATGCTCTATAGCTGGGGCGGCGGTAGCCTGCTGCCGGTAGATACCAGCATCGTTCACTC
CGTCGCGCTGGCTAAAACCACTGCACCGGCAATGGTACTCTTCTTCAAAGGTGCATTGTGT
AACTGGCTGGTTTGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAA
AAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCAT
AAGATTAGCGGATCCTACCTGATGTTTCTTTTTATCGCAACTCTCTACTGTTTCTCCATACC
CGTTTTTTTGGATGGAGTGAAACGATGGCGATTGCAATTGGCCTCGATTTTGGCAGTGATT
CTGTGCGAGCTTTGGCGGTGGACTGCGCTACCGGTGAAGAGATCGCCACCAGCGTAGAG
TGGTATCCCCGTTGGCAGAAAGGGCAATTTTGTGATGCCCCGAATAACCAGTTCCGTCATC
ATCCGCGTGACTACATTGAGTCAATGGAAGCGGCACTGAAAACCGTGCTTGCAGAGCTTA
GCGTCGAACAGCGCGCAGCTGTGGTCGGGATTGGCGTTGACAGTACCGGCTCGACGCCC
GCACCGATTGATGCCGACGGAAACGTGCTGGCGCTGCGCCCGGAGTTTGCCGAAAACCC
GAACGCGATGTTCGTATTGT
2. A colleague of yours performs a PCR experiment (with no controls!), and sees no PCR
amplification. Hypothesis two potential reasons your colleague may have gotten this result.
3. A different colleague performs a PCR experiment (again with no controls!), and sees lots of non-
specific amplification. Hypothesize two potential reasons your colleage may have gotten this result.
4. Identify the bands on the following gel. First, label the bands in the DNA ladder (1 kb, 2 kb, 4 kb, 8
kb and 10 kb). Second, assuming that the three samples are from a PCR experiment, identify the
samples run in lanes 2 - 4. Finally, identify each of the bands in lanes 2 - 4.
2

Top Answer

1. In order to design forward and reverse primers flaking the sequence marked in bold, 25-30 bases of nucleotides on either... View the full answer

Sign up to view the full answer

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question