View the step-by-step solution to:

Question

given DNA

sequence:

TACTCGAATTCATCTGGCGAATCTCGGATCCATCGGCCGATC

ATGAGCTTAAGTAGACCGCTTAGAGCCTAGGTAGCCGGCTAG

1.FIND restriction site and restriction enzyme name

2.how many fragments are made after restriction dijestion

3 do restriction digestion and make different fragments after restriction digestion

4.mention sticky and blunt ends

Top Answer

ANSWER 1 Restriction Site: G---AATTC CTTAA---G Restriction enzyme: Eco RI Restriction Site: GG---CC CC---GG Restriction... View the full answer

Sign up to view the full answer

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question