View the step-by-step solution to:

Question

If we have the following primers and the original primer is given by sequence 1b: If we want to attach different

versions of primers which are given as Archie's version, Betty and veronica which one these versions of primers will results in larger amplification product using pcr and which one will be the least successful and why? I know it has to do with sequence similarity but i am still confuse.

Sequence for primer 1b: 5'-CGACTTTCACATCATCTACAC-3'

              Archie's version of 1a: TATCCATTTAGTAGTGAACGGT

              Betty's version of 1a: TCCATTTAGTAGTGAACGTGTA

              Veronica's version of1a: ATTCCATTTAGTAGTGAACGTG

Recently Asked Questions

Why Join Course Hero?

Course Hero has all the homework and study help you need to succeed! We’ve got course-specific notes, study guides, and practice tests along with expert tutors.

  • -

    Study Documents

    Find the best study resources around, tagged to your specific courses. Share your own to gain free Course Hero access.

    Browse Documents
  • -

    Question & Answers

    Get one-on-one homework help from our expert tutors—available online 24/7. Ask your own questions or browse existing Q&A threads. Satisfaction guaranteed!

    Ask a Question
Ask Expert Tutors You can ask You can ask ( soon) You can ask (will expire )
Answers in as fast as 15 minutes